Vaccino per COVID-19: come funziona l'antivirus?

Preliminari: il codice sorgente della cellula

La cellula è l'unità fondamentale della maggior parte degli organismi viventi.
Ogni cellula può essere immaginata come un microscopica macchina che esegue delle istruzioni ben precise, che garantiscono il suo funzionamento, la sua sopravvivenza e la sua riproduzione. In parole povere, la cellula è un computer su scala microscopica.

Cellula, costituita da un nucleo dove risiede il DNA, una lunga catena di molecole che può essere immaginato come una sequenza che utilizza 4 caratteri: A, G, C, T. Fonte: Understanding the Blueprint for Life


La sequenza di caratteri non è casuale, ed è soggetta ad alcune regole fondamentali. Il DNA è costituito dalla famosa doppia elica – scoperta da Rosalind Franklin, Jim Watson e Francis Crick, che valse agli ultimi due il premio Nobel – dove una A su un'elica si "connette" ad una T sull'altra elica, mentre una C si connette ad una G.

Per usare una prima analogia con l'informatica, le 4 lettere A, G, C, T giocano per il nostro computer biologico lo stesso ruolo che 0 e 1 (bit) giocano per un computer artificiale. Per definizione, gruppi di 8 bits formano un byte (B): per esempio, la memoria da 64 GB (Gigabytes) di uno smartphone contiene 64 x 1024 x 1024 x 1024 x 8 bits, dove è possibile conservare sequenze di numeri (0 e 1) fino ad un massimo di 549.755.813.888 (circa 550 miliardi).
Per confronto, il genoma umano consiste di circa 3.1 miliardi di coppie di caratteri: usando la codifica

A 00 G 10
C 01 T 11

ogni base richiede 2 bit, pertanto sono disponibili 6.2 miliardi di bits (o circa 775MB).

Hard disk genetico: alcuni ricercatori sono riusciti a salvare un intero libro di testo nel codice del DNA. (SERGEY VOLKOV/ISTOCKPHOTO). Fonte: Science

Il DNA permetterebbe di conservare dati con una densità 1000 volte più alta di una memoria flash, preservarli per un tempo 10 volte superiore (oltre 100 anni), con una velocità di lettura inferiore ai 100 microsecondi (un decimo di millisecondo) per bit, ben 30-50 volte più veloce di un disco fisso attuale. La cosa più affascinante è che tutte queste prestazioni sono ottenute con un consumo energetico pari ad un decimo di miliardesimo di Watts per GB, ben 100 milioni di volte in meno di una memoria flash (che consuma un centesimo di Watt per GB). Fonte: Nature


Di fatto, il DNA è la versione biologica di un disco fisso, capace di conservare informazioni per miliardi di anni. Tuttavia queste informazioni devono essere tradotte in "oggetti" che svolgono le funzioni primarie della cellula: questi oggetti sono le proteine, il cui ruolo è quello di "misurare" ed "agire", in gergo informatico (biologicamente sarebbe più corretto dire che il compito delle proteine è quello di assolvere a tutte le funzioni essenziali per la cellula per permetterne la sopravvivenza, lo scambio di informazioni con le cellule limitrofe, etc.). Per creare le proteine, una molecola intermedia deve essere prima generata: l'RNA. Questa è meno stabile del DNA ma decisamente più reattiva. Ci sono alcune differenze strutturali tra DNA ed RNA, ma in questo contesto ci basta sapere che anch'esso è costituito di sequenze di 4 caratteri come il DNA, con la U al posto della T.


Dal DNA alle proteine. Fonte: Nature


Il DNA viene trascritto in catene di RNA messaggero (mRNA) che è una sorta di copia del materiale genetico che serve per produrre una proteina. Di fatto, questa sequenza di caratteri (ricordiamoci che si tratta pur sempre di molecole) viene inviata ai ribosomi, delle altre molecole che giocano un ruolo simile a quello di una stampante 3D. Questi leggono le istruzioni contenute nell'mRNA in gruppi di 3 caratteri (che in gergo prendono il nome di codone e giocano lo stesso ruolo del byte): ogni codone corrisponde ad un amminoacido. Poichè ci sono 4 possibili caratteri, in totale ci possono essere 4 x 4 x 4 = 64 amminoacidi diversi, ma nella pratica ce ne sono molti meno, poichè codoni diversi vengono mappati (o meglio, codificati) sullo stesso amminoacido.

Tabella di conversione da codone ad amminoacido. Fonte: Nature

Ogni amminoacido viene indicato con una diversa lettera dell'alfabeto. Fonte: Wikipedia


In un certo senso, gli amminoacidi sono come i mattoncini Lego della vita: le loro molteplici combinazioni vengono tradotte per dare luogo alla varietà di proteine che vengono prodotte dalla cellula. Questa straordinaria procedura è riassunta nel breve video che segue.


Il codice sorgente di SARS-CoV-2

Così come la cellula umana, anche il virus ha un suo codice genetico costituito dagli stessi caratteri che abbiamo incontrato in precedenza.

Tipi diversi di virus, morfologia e ospiti. Fonte: Scientific American, Credit: AXS Biomedical Animation Studio


Secondo la classificazione di David Baltimore – premio Nobel nel 1975 – ci sono 7 categorie di virus, ma più semplicemente possiamo immaginare che queste riconducano a 2 grandi tipi: i virus il cui genoma è DNA e i virus il cui genoma è RNA.

Caratteristiche comuni a diversi virus e i loro obiettivi principali nel corpo umano. Fonte: Scientific American, Credit: AXS Biomedical Animation Studio



Dal DNA alle proteine. Fonte: Pininterest


Non bisogna farsi ingannare dalle rappresentazioni dei virus, e bisogna ricordare che si tratta sempre di strutture molecolari più o meno complesse. Per esempio, il modello strutturale per SARS-CoV-2 è mostrato di seguito:


Modello strutturale per alcune parti costituenti del SARS-CoV-2. I punti indicano le 4 basi dell'RNA. Fonte: Houston et al 2020


Ma torniamo alla struttura in termini di sequenza di caratteri. Il codice sorgente corrispondente alla struttura molecolare del SARS-CoV-2 è dato da
        1   AUUAAAGGUU UAUACCUUCC CAGGUAACAA ACCAACCAAC UUUCGAUCUC UUGUAGAUCU
       61   GUUCUCUAAA CGAACUUUAA AAUCUGUGUG GCUGUCACUC GGCUGCAUGC UUAGUGCACU
      121   CACGCAGUAU AAUUAAUAAC UAAUUACUGU CGUUGACAGG ACACGAGUAA CUCGUCUAUC
      181   UUCUGCAGGC UGCUUACGGU UUCGUCCGUG UUGCAGCCGA UCAUCAGCAC AUCUAGGUUU
      241   CGUCCGGGUG UGACCGAAAG GUAAGAUGGA GAGCCUUGUC CCUGGUUUCA ACGAGAAAAC
      ...
      29581 UUUUCCGUUU ACGAUAUAUA GUCUACUCUU GUGCAGAAUG AAUUCUCGUA ACUACAUAGC
      29641 ACAAGUAGAU GUAGUUAACU UUAAUCUCAC AUAGCAAUCU UUAAUCAGUG UGUAACAUUA
      29701 GGGAGGACUU GAAAGAGCCA CCACAUUUUC ACCGAGGCCA CGCGGAGUAC GAUCGAGUGU
      29761 ACAGUGAACA AUGCUAGGGA GAGCUGCCUA UAUGGAAGAG CCCUAAUGUG UAAAAUUAAU
      29821 UUUAGUAGUG CUAUCCCCAU GUGAUUUUAA UAGCUUCUUA GGAGAAUGAC AAAAAAAAAA
      29881 AAAAAAAAAA AAAAAAAAAA AAA
                            
per un totale di 29903 caratteri, dove abbiamo omesso la parte intermedia per semplicità (il lettore curioso può trovare qui la sequenza completa). Ebbene si, il sorgente di questo virus è di circa 7.3 KB, molto inferiore all'informazione contenuta in un post su Instagram. Come per un qualunque programma, possiamo analizzare il codice sorgente per determinare i moduli (le proteine) del virus e le loro funzioni.


Proteine del SARS-CoV-2 e loro nome e ubicazione nel genoma del virus. Fonte: Prokop Lab


La prima parte serve al virus per comunicare con i ribosomi della cellula umana:
AUUAAAGGUUUAUACCUUCCCAGGUAACAAACCAACCAACUUUCGAUCUCUUGUAGAUCUGUUCUCUAAACGAACUUUAAAAUCUGUGUGGCUGUCACUCGGCUGCAUGCUUAGUGCACUCACGCAGUAUAAUUAAUAACUAAUUACUGUCGUUGACAGGACACGAGUAACUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUCUAGGUUUCGUCCGGGUGUGACCGAAAGGUAAG
                            
Per chi conosce un minimo di linguaggi di programmazione, questo svolge lo stesso ruolo di:
START virus
...
                            
L'ultima parte contiene una apparentemente insolita sequenza di A: la sorpresa più grande è che si tratta di un codice di uscita che segnala al ribosoma che il contenuto genetico del virus è terminato. Questo equivale allo pseudocodice:
...
CLOSE virus
                            
In mezzo alle istruzioni di START e STOP si trovano le istruzioni per il funzionamento del virus, basato sulla definizione dei suoi moduli funzionali: le singole proteine sono riportate di seguito.
Proteina Funzione Codice
NSP1 Inibisce l'assemblamento di proteine antivirali
AUGGAGAGCCUUGUCCCUGGUUUCAACGAGAAAACACACGUCCAACUCAGUUUGCCUGUUUUACAGGUUCGCGACGUGCUCGUACGUGGCUUUGGAGACUCCGUGGAGGAGGUCUUAUCAGAGGCACGUCAACAUCUUAAAGAUGGCACUUGUGGCUUAGUAGAAGUUGAAAAAGGCGUUUUGCCUCAACUUGAACAGCCCUAUGUGUUCAUCAAACGUUCGGAUGCUCGAACUGCACCUCAUGGUCAUGUUAUGGUUGAGCUGGUAGCAGAACUCGAAGGCAUUCAGUACGGUCGUAGUGGUGAGACACUUGGUGUCCUUGUCCCUCAUGUGGGCGAAAUACCAGUGGCUUACCGCAAGGUUCUUCUUCGUAAGAACGGUAAUAAAGGAGCUGGUGGCCAUAGUUACGGCGCCGAUCUAAAGUCAUUUGACUUAGGCGACGAGCUUGGCACUGAUCCUUAUGAAGAUUUUCAAGAAAACUGGAACACUAAACAUAGCAGUGGUGUUACCCGUGAACUCAUGCGUGAGCUUAACGGAGGG
                                        
NSP2 Sconosciuta
GCAUACACUCGCUAUGUCGAUAACAACUUCUGUGGCCCUGAUGGCUACCCUCUUGAGUGCAUUAAAGACCUUCUAGCACGUGCUGGUAAAGCUUCAUGCACUUUGUCCGAACAACUGGACUUUAUUGACACUAAGAGGGGUGUAUACUGCUGCCGUGAACAUGAGCAUGAAAUUGCUUGGUACACGGAACGUUCUGAAAAGAGCUAUGAAUUGCAGACACCUUUUGAAAUUAAAUUGGCAAAGAAAUUUGACACCUUCAAUGGGGAAUGUCCAAAUUUUGUAUUUCCCUUAAAUUCCAUAAUCAAGACUAUUCAACCAAGGGUUGAAAAGAAAAAGCUUGAUGGCUUUAUGGGUAGAAUUCGAUCUGUCUAUCCAGUUGCGUCACCAAAUGAAUGCAACCAAAUGUGCCUUUCAACUCUCAUGAAGUGUGAUCAUUGUGGUGAAACUUCAUGGCAGACGGGCGAUUUUGUUAAAGCCACUUGCGAAUUUUGUGGCACUGAGAAUUUGACUAAAGAAGGUGCCACUACUUGUGGUUACUUACCCCAAAAUGCUGUUGUUAAAAUUUAUUGUCCAGCAUGUCACAAUUCAGAAGUAGGACCUGAGCAUAGUCUUGCCGAAUACCAUAAUGAAUCUGGCUUGAAAACCAUUCUUCGUAAGGGUGGUCGCACUAUUGCCUUUGGAGGCUGUGUGUUCUCUUAUGUUGGUUGCCAUAACAAGUGUGCCUAUUGGGUUCCACGUGCUAGCGCUAACAUAGGUUGUAACCAUACAGGUGUUGUUGGAGAAGGUUCCGAAGGUCUUAAUGACAACCUUCUUGAAAUACUCCAAAAAGAGAAAGUCAACAUCAAUAUUGUUGGUGACUUUAAACUUAAUGAAGAGAUCGCCAUUAUUUUGGCAUCUUUUUCUGCUUCCACAAGUGCUUUUGUGGAAACUGUGAAAGGUUUGGAUUAUAAAGCAUUCAAACAAAUUGUUGAAUCCUGUGGUAAUUUUAAAGUUACAAAAGGAAAAGCUAAAAAAGGUGCCUGGAAUAUUGGUGAACAGAAAUCAAUACUGAGUCCUCUUUAUGCAUUUGCAUCAGAGGCUGCUCGUGUUGUACGAUCAAUUUUCUCCCGCACUCUUGAAACUGCUCAAAAUUCUGUGCGUGUUUUACAGAAGGCCGCUAUAACAAUACUAGAUGGAAUUUCACAGUAUUCACUGAGACUCAUUGAUGCUAUGAUGUUCACAUCUGAUUUGGCUACUAACAAUCUAGUUGUAAUGGCCUACAUUACAGGUGGUGUUGUUCAGUUGACUUCGCAGUGGCUAACUAACAUCUUUGGCACUGUUUAUGAAAAACUCAAACCCGUCCUUGAUUGGCUUGAAGAGAAGUUUAAGGAAGGUGUAGAGUUUCUUAGAGACGGUUGGGAAAUUGUUAAAUUUAUCUCAACCUGUGCUUGUGAAAUUGUCGGUGGACAAAUUGUCACCUGUGCAAAGGAAAUUAAGGAGAGUGUUCAGACAUUCUUUAAGCUUGUAAAUAAAUUUUUGGCUUUGUGUGCUGACUCUAUCAUUAUUGGUGGAGCUAAACUUAAAGCCUUGAAUUUAGGUGAAACAUUUGUCACGCACUCAAAGGGAUUGUACAGAAAGUGUGUUAAAUCCAGAGAAGAAACUGGCCUACUCAUGCCUCUAAAAGCCCCAAAAGAAAUUAUCUUCUUAGAGGGAGAAACACUUCCCACAGAAGUGUUAACAGAGGAAGUUGUCUUGAAAACUGGUGAUUUACAACCAUUAGAACAACCUACUAGUGAAGCUGUUGAAGCUCCAUUGGUUGGUACACCAGUUUGUAUUAACGGGCUUAUGUUGCUCGAAAUCAAAGACACAGAAAAGUACUGUGCCCUUGCACCUAAUAUGAUGGUAACAAACAAUACCUUCACACUCAAAGGCGGU
                                        
Papain-like proteinase (o NSP3) Processamento di poliproteine virali e diffusione virale
GCACCAACAAAGGUUACUUUUGGUGAUGACACUGUGAUAGAAGUGCAAGGUUACAAGAGUGUGAAUAUCACUUUUGAACUUGAUGAAAGGAUUGAUAAAGUACUUAAUGAGAAGUGCUCUGCCUAUACAGUUGAACUCGGUACAGAAGUAAAUGAGUUCGCCUGUGUUGUGGCAGAUGCUGUCAUAAAAACUUUGCAACCAGUAUCUGAAUUACUUACACCACUGGGCAUUGAUUUAGAUGAGUGGAGUAUGGCUACAUACUACUUAUUUGAUGAGUCUGGUGAGUUUAAAUUGGCUUCACAUAUGUAUUGUUCUUUCUACCCUCCAGAUGAGGAUGAAGAAGAAGGUGAUUGUGAAGAAGAAGAGUUUGAGCCAUCAACUCAAUAUGAGUAUGGUACUGAAGAUGAUUACCAAGGUAAACCUUUGGAAUUUGGUGCCACUUCUGCUGCUCUUCAACCUGAAGAAGAGCAAGAAGAAGAUUGGUUAGAUGAUGAUAGUCAACAAACUGUUGGUCAACAAGACGGCAGUGAGGACAAUCAGACAACUACUAUUCAAACAAUUGUUGAGGUUCAACCUCAAUUAGAGAUGGAACUUACACCAGUUGUUCAGACUAUUGAAGUGAAUAGUUUUAGUGGUUAUUUAAAACUUACUGACAAUGUAUACAUUAAAAAUGCAGACAUUGUGGAAGAAGCUAAAAAGGUAAAACCAACAGUGGUUGUUAAUGCAGCCAAUGUUUACCUUAAACAUGGAGGAGGUGUUGCAGGAGCCUUAAAUAAGGCUACUAACAAUGCCAUGCAAGUUGAAUCUGAUGAUUACAUAGCUACUAAUGGACCACUUAAAGUGGGUGGUAGUUGUGUUUUAAGCGGACACAAUCUUGCUAAACACUGUCUUCAUGUUGUCGGCCCAAAUGUUAACAAAGGUGAAGACAUUCAACUUCUUAAGAGUGCUUAUGAAAAUUUUAAUCAGCACGAAGUUCUACUUGCACCAUUAUUAUCAGCUGGUAUUUUUGGUGCUGACCCUAUACAUUCUUUAAGAGUUUGUGUAGAUACUGUUCGCACAAAUGUCUACUUAGCUGUCUUUGAUAAAAAUCUCUAUGACAAACUUGUUUCAAGCUUUUUGGAAAUGAAGAGUGAAAAGCAAGUUGAACAAAAGAUCGCUGAGAUUCCUAAAGAGGAAGUUAAGCCAUUUAUAACUGAAAGUAAACCUUCAGUUGAACAGAGAAAACAAGAUGAUAAGAAAAUCAAAGCUUGUGUUGAAGAAGUUACAACAACUCUGGAAGAAACUAAGUUCCUCACAGAAAACUUGUUACUUUAUAUUGACAUUAAUGGCAAUCUUCAUCCAGAUUCUGCCACUCUUGUUAGUGACAUUGACAUCACUUUCUUAAAGAAAGAUGCUCCAUAUAUAGUGGGUGAUGUUGUUCAAGAGGGUGUUUUAACUGCUGUGGUUAUACCUACUAAAAAGGCUGGUGGCACUACUGAAAUGCUAGCGAAAGCUUUGAGAAAAGUGCCAACAGACAAUUAUAUAACCACUUACCCGGGUCAGGGUUUAAAUGGUUACACUGUAGAGGAGGCAAAGACAGUGCUUAAAAAGUGUAAAAGUGCCUUUUACAUUCUACCAUCUAUUAUCUCUAAUGAGAAGCAAGAAAUUCUUGGAACUGUUUCUUGGAAUUUGCGAGAAAUGCUUGCACAUGCAGAAGAAACACGCAAAUUAAUGCCUGUCUGUGUGGAAACUAAAGCCAUAGUUUCAACUAUACAGCGUAAAUAUAAGGGUAUUAAAAUACAAGAGGGUGUGGUUGAUUAUGGUGCUAGAUUUUACUUUUACACCAGUAAAACAACUGUAGCGUCACUUAUCAACACACUUAACGAUCUAAAUGAAACUCUUGUUACAAUGCCACUUGGCUAUGUAACACAUGGCUUAAAUUUGGAAGAAGCUGCUCGGUAUAUGAGAUCUCUCAAAGUGCCAGCUACAGUUUCUGUUUCUUCACCUGAUGCUGUUACAGCGUAUAAUGGUUAUCUUACUUCUUCUUCUAAAACACCUGAAGAACAUUUUAUUGAAACCAUCUCACUUGCUGGUUCCUAUAAAGAUUGGUCCUAUUCUGGACAAUCUACACAACUAGGUAUAGAAUUUCUUAAGAGAGGUGAUAAAAGUGUAUAUUACACUAGUAAUCCUACCACAUUCCACCUAGAUGGUGAAGUUAUCACCUUUGACAAUCUUAAGACACUUCUUUCUUUGAGAGAAGUGAGGACUAUUAAGGUGUUUACAACAGUAGACAACAUUAACCUCCACACGCAAGUUGUGGACAUGUCAAUGACAUAUGGACAACAGUUUGGUCCAACUUAUUUGGAUGGAGCUGAUGUUACUAAAAUAAAACCUCAUAAUUCACAUGAAGGUAAAACAUUUUAUGUUUUACCUAAUGAUGACACUCUACGUGUUGAGGCUUUUGAGUACUACCACACAACUGAUCCUAGUUUUCUGGGUAGGUACAUGUCAGCAUUAAAUCACACUAAAAAGUGGAAAUACCCACAAGUUAAUGGUUUAACUUCUAUUAAAUGGGCAGAUAACAACUGUUAUCUUGCCACUGCAUUGUUAACACUCCAACAAAUAGAGUUGAAGUUUAAUCCACCUGCUCUACAAGAUGCUUAUUACAGAGCAAGGGCUGGUGAAGCUGCUAACUUUUGUGCACUUAUCUUAGCCUACUGUAAUAAGACAGUAGGUGAGUUAGGUGAUGUUAGAGAAACAAUGAGUUACUUGUUUCAACAUGCCAAUUUAGAUUCUUGCAAAAGAGUCUUGAACGUGGUGUGUAAAACUUGUGGACAACAGCAGACAACCCUUAAGGGUGUAGAAGCUGUUAUGUACAUGGGCACACUUUCUUAUGAACAAUUUAAGAAAGGUGUUCAGAUACCUUGUACGUGUGGUAAACAAGCUACAAAAUAUCUAGUACAACAGGAGUCACCUUUUGUUAUGAUGUCAGCACCACCUGCUCAGUAUGAACUUAAGCAUGGUACAUUUACUUGUGCUAGUGAGUACACUGGUAAUUACCAGUGUGGUCACUAUAAACAUAUAACUUCUAAAGAAACUUUGUAUUGCAUAGACGGUGCUUUACUUACAAAGUCCUCAGAAUACAAAGGUCCUAUUACGGAUGUUUUCUACAAAGAAAACAGUUACACAACAACCAUAAAACCAGUUACUUAUAAAUUGGAUGGUGUUGUUUGUACAGAAAUUGACCCUAAGUUGGACAAUUAUUAUAAGAAAGACAAUUCUUAUUUCACAGAGCAACCAAUUGAUCUUGUACCAAACCAACCAUAUCCAAACGCAAGCUUCGAUAAUUUUAAGUUUGUAUGUGAUAAUAUCAAAUUUGCUGAUGAUUUAAACCAGUUAACUGGUUAUAAGAAACCUGCUUCAAGAGAGCUUAAAGUUACAUUUUUCCCUGACUUAAAUGGUGAUGUGGUGGCUAUUGAUUAUAAACACUACACACCCUCUUUUAAGAAAGGAGCUAAAUUGUUACAUAAACCUAUUGUUUGGCAUGUUAACAAUGCAACUAAUAAAGCCACGUAUAAACCAAAUACCUGGUGUAUACGUUGUCUUUGGAGCACAAAACCAGUUGAAACAUCAAAUUCGUUUGAUGUACUGAAGUCAGAGGACGCGCAGGGAAUGGAUAAUCUUGCCUGCGAAGAUCUAAAACCAGUCUCUGAAGAAGUAGUGGAAAAUCCUACCAUACAGAAAGACGUUCUUGAGUGUAAUGUGAAAACUACCGAAGUUGUAGGAGACAUUAUACUUAAACCAGCAAAUAAUAGUUUAAAAAUUACAGAAGAGGUUGGCCACACAGAUCUAAUGGCUGCUUAUGUAGACAAUUCUAGUCUUACUAUUAAGAAACCUAAUGAAUUAUCUAGAGUAUUAGGUUUGAAAACCCUUGCUACUCAUGGUUUAGCUGCUGUUAAUAGUGUCCCUUGGGAUACUAUAGCUAAUUAUGCUAAGCCUUUUCUUAACAAAGUUGUUAGUACAACUACUAACAUAGUUACACGGUGUUUAAACCGUGUUUGUACUAAUUAUAUGCCUUAUUUCUUUACUUUAUUGCUACAAUUGUGUACUUUUACUAGAAGUACAAAUUCUAGAAUUAAAGCAUCUAUGCCGACUACUAUAGCAAAGAAUACUGUUAAGAGUGUCGGUAAAUUUUGUCUAGAGGCUUCAUUUAAUUAUUUGAAGUCACCUAAUUUUUCUAAACUGAUAAAUAUUAUAAUUUGGUUUUUACUAUUAAGUGUUUGCCUAGGUUCUUUAAUCUACUCAACCGCUGCUUUAGGUGUUUUAAUGUCUAAUUUAGGCAUGCCUUCUUACUGUACUGGUUACAGAGAAGGCUAUUUGAACUCUACUAAUGUCACUAUUGCAACCUACUGUACUGGUUCUAUACCUUGUAGUGUUUGUCUUAGUGGUUUAGAUUCUUUAGACACCUAUCCUUCUUUAGAAACUAUACAAAUUACCAUUUCAUCUUUUAAAUGGGAUUUAACUGCUUUUGGCUUAGUUGCAGAGUGGUUUUUGGCAUAUAUUCUUUUCACUAGGUUUUUCUAUGUACUUGGAUUGGCUGCAAUCAUGCAAUUGUUUUUCAGCUAUUUUGCAGUACAUUUUAUUAGUAAUUCUUGGCUUAUGUGGUUAAUAAUUAAUCUUGUACAAAUGGCCCCGAUUUCAGCUAUGGUUAGAAUGUACAUCUUCUUUGCAUCAUUUUAUUAUGUAUGGAAAAGUUAUGUGCAUGUUGUAGACGGUUGUAAUUCAUCAACUUGUAUGAUGUGUUACAAACGUAAUAGAGCAACAAGAGUCGAAUGUACAACUAUUGUUAAUGGUGUUAGAAGGUCCUUUUAUGUCUAUGCUAAUGGAGGUAAAGGCUUUUGCAAACUACACAAUUGGAAUUGUGUUAAUUGUGAUACAUUCUGUGCUGGUAGUACAUUUAUUAGUGAUGAAGUUGCGAGAGACUUGUCACUACAGUUUAAAAGACCAAUAAAUCCUACUGACCAGUCUUCUUACAUCGUUGAUAGUGUUACAGUGAAGAAUGGUUCCAUCCAUCUUUACUUUGAUAAAGCUGGUCAAAAGACUUAUGAAAGACAUUCUCUCUCUCAUUUUGUUAACUUAGACAACCUGAGAGCUAAUAACACUAAAGGUUCAUUGCCUAUUAAUGUUAUAGUUUUUGAUGGUAAAUCAAAAUGUGAAGAAUCAUCUGCAAAAUCAGCGUCUGUUUACUACAGUCAGCUUAUGUGUCAACCUAUACUGUUACUAGAUCAGGCAUUAGUGUCUGAUGUUGGUGAUAGUGCGGAAGUUGCAGUUAAAAUGUUUGAUGCUUACGUUAAUACGUUUUCAUCAACUUUUAACGUACCAAUGGAAAAACUCAAAACACUAGUUGCAACUGCAGAAGCUGAACUUGCAAAGAAUGUGUCCUUAGACAAUGUCUUAUCUACUUUUAUUUCAGCAGCUCGGCAAGGGUUUGUUGAUUCAGAUGUAGAAACUAAAGAUGUUGUUGAAUGUCUUAAAUUGUCACAUCAAUCUGACAUAGAAGUUACUGGCGAUAGUUGUAAUAACUAUAUGCUCACCUAUAACAAAGUUGAAAACAUGACACCCCGUGACCUUGGUGCUUGUAUUGACUGUAGUGCGCGUCAUAUUAAUGCGCAGGUAGCAAAAAGUCACAACAUUGCUUUGAUAUGGAACGUUAAAGAUUUCAUGUCAUUGUCUGAACAACUACGAAAACAAAUACGUAGUGCUGCUAAAAAGAAUAACUUACCUUUUAAGUUGACAUGUGCAACUACUAGACAAGUUGUUAAUGUUGUAACAACAAAGAUAGCACUUAAGGGUGGU
                                        
NSP4 Duplicazione virale
AAAAUUGUUAAUAAUUGGUUGAAGCAGUUAAUUAAAGUUACACUUGUGUUCCUUUUUGUUGCUGCUAUUUUCUAUUUAAUAACACCUGUUCAUGUCAUGUCUAAACAUACUGACUUUUCAAGUGAAAUCAUAGGAUACAAGGCUAUUGAUGGUGGUGUCACUCGUGACAUAGCAUCUACAGAUACUUGUUUUGCUAACAAACAUGCUGAUUUUGACACAUGGUUUAGCCAGCGUGGUGGUAGUUAUACUAAUGACAAAGCUUGCCCAUUGAUUGCUGCAGUCAUAACAAGAGAAGUGGGUUUUGUCGUGCCUGGUUUGCCUGGCACGAUAUUACGCACAACUAAUGGUGACUUUUUGCAUUUCUUACCUAGAGUUUUUAGUGCAGUUGGUAACAUCUGUUACACACCAUCAAAACUUAUAGAGUACACUGACUUUGCAACAUCAGCUUGUGUUUUGGCUGCUGAAUGUACAAUUUUUAAAGAUGCUUCUGGUAAGCCAGUACCAUAUUGUUAUGAUACCAAUGUACUAGAAGGUUCUGUUGCUUAUGAAAGUUUACGCCCUGACACACGUUAUGUGCUCAUGGAUGGCUCUAUUAUUCAAUUUCCUAACACCUACCUUGAAGGUUCUGUUAGAGUGGUAACAACUUUUGAUUCUGAGUACUGUAGGCACGGCACUUGUGAAAGAUCAGAAGCUGGUGUUUGUGUAUCUACUAGUGGUAGAUGGGUACUUAACAAUGAUUAUUACAGAUCUUUACCAGGAGUUUUCUGUGGUGUAGAUGCUGUAAAUUUACUUACUAAUAUGUUUACACCACUAAUUCAACCUAUUGGUGCUUUGGACAUAUCAGCAUCUAUAGUAGCUGGUGGUAUUGUAGCUAUCGUAGUAACAUGCCUUGCCUACUAUUUUAUGAGGUUUAGAAGAGCUUUUGGUGAAUACAGUCAUGUAGUUGCCUUUAAUACUUUACUAUUCCUUAUGUCAUUCACUGUACUCUGUUUAACACCAGUUUACUCAUUCUUACCUGGUGUUUAUUCUGUUAUUUACUUGUACUUGACAUUUUAUCUUACUAAUGAUGUUUCUUUUUUAGCACAUAUUCAGUGGAUGGUUAUGUUCACACCUUUAGUACCUUUCUGGAUAACAAUUGCUUAUAUCAUUUGUAUUUCCACAAAGCAUUUCUAUUGGUUCUUUAGUAAUUACCUAAAGAGACGUGUAGUCUUUAAUGGUGUUUCCUUUAGUACUUUUGAAGAAGCUGCGCUGUGCACCUUUUUGUUAAAUAAAGAAAUGUAUCUAAAGUUGCGUAGUGAUGUGCUAUUACCUCUUACGCAAUAUAAUAGAUACUUAGCUCUUUAUAAUAAGUACAAGUAUUUUAGUGGAGCAAUGGAUACAACUAGCUACAGAGAAGCUGCUUGUUGUCAUCUCGCAAAGGCUCUCAAUGACUUCAGUAACUCAGGUUCUGAUGUUCUUUACCAACCACCACAAACCUCUAUCACCUCAGCUGUUUUGCAG
                                        
3C-like proteinase (o NSP5) Separazione delle proteine virali
AGUGGUUUUAGAAAAAUGGCAUUCCCAUCUGGUAAAGUUGAGGGUUGUAUGGUACAAGUAACUUGUGGUACAACUACACUUAACGGUCUUUGGCUUGAUGACGUAGUUUACUGUCCAAGACAUGUGAUCUGCACCUCUGAAGACAUGCUUAACCCUAAUUAUGAAGAUUUACUCAUUCGUAAGUCUAAUCAUAAUUUCUUGGUACAGGCUGGUAAUGUUCAACUCAGGGUUAUUGGACAUUCUAUGCAAAAUUGUGUACUUAAGCUUAAGGUUGAUACAGCCAAUCCUAAGACACCUAAGUAUAAGUUUGUUCGCAUUCAACCAGGACAGACUUUUUCAGUGUUAGCUUGUUACAAUGGUUCACCAUCUGGUGUUUACCAAUGUGCUAUGAGGCCCAAUUUCACUAUUAAGGGUUCAUUCCUUAAUGGUUCAUGUGGUAGUGUUGGUUUUAACAUAGAUUAUGACUGUGUCUCUUUUUGUUACAUGCACCAUAUGGAAUUACCAACUGGAGUUCAUGCUGGCACAGACUUAGAAGGUAACUUUUAUGGACCUUUUGUUGACAGGCAAACAGCACAAGCAGCUGGUACGGACACAACUAUUACAGUUAAUGUUUUAGCUUGGUUGUACGCUGCUGUUAUAAAUGGAGACAGGUGGUUUCUCAAUCGAUUUACCACAACUCUUAAUGACUUUAACCUUGUGGCUAUGAAGUACAAUUAUGAACCUCUAACACAAGACCAUGUUGACAUACUAGGACCUCUUUCUGCUCAAACUGGAAUUGCCGUUUUAGAUAUGUGUGCUUCAUUAAAAGAAUUACUGCAAAAUGGUAUGAAUGGACGUACCAUAUUGGGUAGUGCUUUAUUAGAAGAUGAAUUUACACCUUUUGAUGUUGUUAGACAAUGCUCAGGUGUUACUUUCCAA
                                        
NSP6 Duplicazione virale
AGUGCAGUGAAAAGAACAAUCAAGGGUACACACCACUGGUUGUUACUCACAAUUUUGACUUCACUUUUAGUUUUAGUCCAGAGUACUCAAUGGUCUUUGUUCUUUUUUUUGUAUGAAAAUGCCUUUUUACCUUUUGCUAUGGGUAUUAUUGCUAUGUCUGCUUUUGCAAUGAUGUUUGUCAAACAUAAGCAUGCAUUUCUCUGUUUGUUUUUGUUACCUUCUCUUGCCACUGUAGCUUAUUUUAAUAUGGUCUAUAUGCCUGCUAGUUGGGUGAUGCGUAUUAUGACAUGGUUGGAUAUGGUUGAUACUAGUUUGUCUGGUUUUAAGCUAAAAGACUGUGUUAUGUAUGCAUCAGCUGUAGUGUUACUAAUCCUUAUGACAGCAAGAACUGUGUAUGAUGAUGGUGCUAGGAGAGUGUGGACACUUAUGAAUGUCUUGACACUCGUUUAUAAAGUUUAUUAUGGUAAUGCUUUAGAUCAAGCCAUUUCCAUGUGGGCUCUUAUAAUCUCUGUUACUUCUAACUACUCAGGUGUAGUUACAACUGUCAUGUUUUUGGCCAGAGGUAUUGUUUUUAUGUGUGUUGAGUAUUGCCCUAUUUUCUUCAUAACUGGUAAUACACUUCAGUGUAUAAUGCUAGUUUAUUGUUUCUUAGGCUAUUUUUGUACUUGUUACUUUGGCCUCUUUUGUUUACUCAACCGCUACUUUAGACUGACUCUUGGUGUUUAUGAUUACUUAGUUUCUACACAGGAGUUUAGAUAUAUGAAUUCACAGGGACUACUCCCACCCAAGAAUAGCAUAGAUGCCUUCAAACUCAACAUUAAAUUGUUGGGUGUUGGUGGCAAACCUUGUAUCAAAGUAGCCACUGUACAG
                                        
NSP7 Duplicazione virale
UCUAAAAUGUCAGAUGUAAAGUGCACAUCAGUAGUCUUACUCUCAGUUUUGCAACAACUCAGAGUAGAAUCAUCAUCUAAAUUGUGGGCUCAAUGUGUCCAGUUACACAAUGACAUUCUCUUAGCUAAAGAUACUACUGAAGCCUUUGAAAAAAUGGUUUCACUACUUUCUGUUUUGCUUUCCAUGCAGGGUGCUGUAGACAUAAACAAGCUUUGUGAAGAAAUGCUGGACAACAGGGCAACCUUACAA
                                        
NSP8 Duplicazione virale
GCUAUAGCCUCAGAGUUUAGUUCCCUUCCAUCAUAUGCAGCUUUUGCUACUGCUCAAGAAGCUUAUGAGCAGGCUGUUGCUAAUGGUGAUUCUGAAGUUGUUCUUAAAAAGUUGAAGAAGUCUUUGAAUGUGGCUAAAUCUGAAUUUGACCGUGAUGCAGCCAUGCAACGUAAGUUGGAAAAGAUGGCUGAUCAAGCUAUGACCCAAAUGUAUAAACAGGCUAGAUCUGAGGACAAGAGGGCAAAAGUUACUAGUGCUAUGCAGACAAUGCUUUUCACUAUGCUUAGAAAGUUGGAUAAUGAUGCACUCAACAACAUUAUCAACAAUGCAAGAGAUGGUUGUGUUCCCUUGAACAUAAUACCUCUUACAACAGCAGCCAAACUAAUGGUUGUCAUACCAGACUAUAACACAUAUAAAAAUACGUGUGAUGGUACAACAUUUACUUAUGCAUCAGCAUUGUGGGAAAUCCAACAGGUUGUAGAUGCAGAUAGUAAAAUUGUUCAACUUAGUGAAAUUAGUAUGGACAAUUCACCUAAUUUAGCAUGGCCUCUUAUUGUAACAGCUUUAAGGGCCAAUUCUGCUGUCAAAUUACAG
                                        
NSP9 Sconosciuta
AAUAAUGAGCUUAGUCCUGUUGCACUACGACAGAUGUCUUGUGCUGCCGGUACUACACAAACUGCUUGCACUGAUGACAAUGCGUUAGCUUACUACAACACAACAAAGGGAGGUAGGUUUGUACUUGCACUGUUAUCCGAUUUACAGGAUUUGAAAUGGGCUAGAUUCCCUAAGAGUGAUGGAACUGGUACUAUCUAUACAGAACUGGAACCACCUUGUAGGUUUGUUACAGACACACCUAAAGGUCCUAAAGUGAAGUAUUUAUACUUUAUUAAAGGAUUAAACAACCUAAAUAGAGGUAUGGUACUUGGUAGUUUAGCUGCCACAGUACGUCUACAA
                                        
NSP10 Evasione controlli del sistema immunitario
GCUGGUAAUGCAACAGAAGUGCCUGCCAAUUCAACUGUAUUAUCUUUCUGUGCUUUUGCUGUAGAUGCUGCUAAAGCUUACAAAGAUUAUCUAGCUAGUGGGGGACAACCAAUCACUAAUUGUGUUAAGAUGUUGUGUACACACACUGGUACUGGUCAGGCAAUAACAGUUACACCGGAAGCCAAUAUGGAUCAAGAAUCCUUUGGUGGUGCAUCGUGUUGUCUGUACUGCCGUUGCCACAUAGAUCAUCCAAAUCCUAAAGGAUUUUGUGACUUAAAAGGUAAGUAUGUACAAAUACCUACAACUUGUGCUAAUGACCCUGUGGGUUUUACACUUAAAAACACAGUCUGUACCGUCUGCGGUAUGUGGAAAGGUUAUGGCUGUAGUUGUGAUCAACUCCGCGAACCCAUGCUUCAG
                                        
RNA-directed RNA polymerase (o ORF1ab o NSP12) Replicazione e trascrizione dell'informazione virale (poliproteina in sequenza di amminoacidi)
SADAQSFLNRVCGVSAARLTPCGTGTSTDVVYRAFDIYNDKVAGFAKFLKTNCCRFQEKDEDDNLIDSYFVVKRHTFSNYQHEETIYNLLKDCPAVAKHDFFKFRIDGDMVPHISRQRLTKYTMADLVYALRHFDEGNCDTLKEILVTYNCCDDDYFNKKDWYDFVENPDILRVYANLGERVRQALLKTVQFCDAMRNAGIVGVLTLDNQDLNGNWYDFGDFIQTTPGSGVPVVDSYYSLLMPILTLTRALTAESHVDTDLTKPYIKWDLLKYDFTEERLKLFDRYFKYWDQTYHPNCVNCLDDRCILHCANFNVLFSTVFPPTSFGPLVRKIFVDGVPFVVSTGYHFRELGVVHNQDVNLHSSRLSFKELLVYAADPAMHAASGNLLLDKRTTCFSVAALTNNVAFQTVKPGNFNKDFYDFAVSKGFFKEGSSVELKHFFFAQDGNAAISDYDYYRYNLPTMCDIRQLLFVVEVVDKYFDCYDGGCINANQVIVNNLDKSAGFPFNKWGKARLYYDSMSYEDQDALFAYTKRNVIPTITQMNLKYAISAKNRARTVAGVSICSTMTNRQFHQKLLKSIAATRGATVVIGTSKFYGGWHNMLKTVYSDVENPHLMGWDYPKCDRAMPNMLRIMASLVLARKHTTCCSLSHRFYRLANECAQVLSEMVMCGGSLYVKPGGTSSGDATTAYANSVFNICQAVTANVNALLSTDGNKIADKYVRNLQHRLYECLYRNRDVDTDFVNEFYAYLRKHFSMMILSDDAVVCFNSTYASQGLVASIKNFKSVLYYQNNVFMSEAKCWTETDLTKGPHEFCSQHTMLVKQGDDYVYLPYPDPSRILGAGCFVDDIVKTDGTLMIERFVSLAIDAYPLTKHPNQEYADVFHLYLQYIRKLHDELTGHMLDMYSVMLTNDNTSRYWEPEFYEAMYTPHTVLQ
                                        
Helicase (o NSP13) Multifunzionale
GCUGUUGGGGCUUGUGUUCUUUGCAAUUCACAGACUUCAUUAAGAUGUGGUGCUUGCAUACGUAGACCAUUCUUAUGUUGUAAAUGCUGUUACGACCAUGUCAUAUCAACAUCACAUAAAUUAGUCUUGUCUGUUAAUCCGUAUGUUUGCAAUGCUCCAGGUUGUGAUGUCACAGAUGUGACUCAACUUUACUUAGGAGGUAUGAGCUAUUAUUGUAAAUCACAUAAACCACCCAUUAGUUUUCCAUUGUGUGCUAAUGGACAAGUUUUUGGUUUAUAUAAAAAUACAUGUGUUGGUAGCGAUAAUGUUACUGACUUUAAUGCAAUUGCAACAUGUGACUGGACAAAUGCUGGUGAUUACAUUUUAGCUAACACCUGUACUGAAAGACUCAAGCUUUUUGCAGCAGAAACGCUCAAAGCUACUGAGGAGACAUUUAAACUGUCUUAUGGUAUUGCUACUGUACGUGAAGUGCUGUCUGACAGAGAAUUACAUCUUUCAUGGGAAGUUGGUAAACCUAGACCACCACUUAACCGAAAUUAUGUCUUUACUGGUUAUCGUGUAACUAAAAACAGUAAAGUACAAAUAGGAGAGUACACCUUUGAAAAAGGUGACUAUGGUGAUGCUGUUGUUUACCGAGGUACAACAACUUACAAAUUAAAUGUUGGUGAUUAUUUUGUGCUGACAUCACAUACAGUAAUGCCAUUAAGUGCACCUACACUAGUGCCACAAGAGCACUAUGUUAGAAUUACUGGCUUAUACCCAACACUCAAUAUCUCAGAUGAGUUUUCUAGCAAUGUUGCAAAUUAUCAAAAGGUUGGUAUGCAAAAGUAUUCUACACUCCAGGGACCACCUGGUACUGGUAAGAGUCAUUUUGCUAUUGGCCUAGCUCUCUACUACCCUUCUGCUCGCAUAGUGUAUACAGCUUGCUCUCAUGCCGCUGUUGAUGCACUAUGUGAGAAGGCAUUAAAAUAUUUGCCUAUAGAUAAAUGUAGUAGAAUUAUACCUGCACGUGCUCGUGUAGAGUGUUUUGAUAAAUUCAAAGUGAAUUCAACAUUAGAACAGUAUGUCUUUUGUACUGUAAAUGCAUUGCCUGAGACGACAGCAGAUAUAGUUGUCUUUGAUGAAAUUUCAAUGGCCACAAAUUAUGAUUUGAGUGUUGUCAAUGCCAGAUUACGUGCUAAGCACUAUGUGUACAUUGGCGACCCUGCUCAAUUACCUGCACCACGCACAUUGCUAACUAAGGGCACACUAGAACCAGAAUAUUUCAAUUCAGUGUGUAGACUUAUGAAAACUAUAGGUCCAGACAUGUUCCUCGGAACUUGUCGGCGUUGUCCUGCUGAAAUUGUUGACACUGUGAGUGCUUUGGUUUAUGAUAAUAAGCUUAAAGCACAUAAAGACAAAUCAGCUCAAUGCUUUAAAAUGUUUUAUAAGGGUGUUAUCACGCAUGAUGUUUCAUCUGCAAUUAACAGGCCACAAAUAGGCGUGGUAAGAGAAUUCCUUACACGUAACCCUGCUUGGAGAAAAGCUGUCUUUAUUUCACCUUAUAAUUCACAGAAUGCUGUAGCCUCAAAGAUUUUGGGACUACCAACUCAAACUGUUGAUUCAUCACAGGGCUCAGAAUAUGACUAUGUCAUAUUCACUCAAACCACUGAAACAGCUCACUCUUGUAAUGUAAACAGAUUUAAUGUUGCUAUUACCAGAGCAAAAGUAGGCAUACUUUGCAUAAUGUCUGAUAGAGACCUUUAUGACAAGUUGCAAUUUACAAGUCUUGAAAUUCCACGUAGGAAUGUGGCAACUUUACAA
                                        
Guanine-N7 methyltransferase (o NSP14) Correzione degli errori di duplicazione
GCUGAAAAUGUAACAGGACUCUUUAAAGAUUGUAGUAAGGUAAUCACUGGGUUACAUCCUACACAGGCACCUACACACCUCAGUGUUGACACUAAAUUCAAAACUGAAGGUUUAUGUGUUGACAUACCUGGCAUACCUAAGGACAUGACCUAUAGAAGACUCAUCUCUAUGAUGGGUUUUAAAAUGAAUUAUCAAGUUAAUGGUUACCCUAACAUGUUUAUCACCCGCGAAGAAGCUAUAAGACAUGUACGUGCAUGGAUUGGCUUCGAUGUCGAGGGGUGUCAUGCUACUAGAGAAGCUGUUGGUACCAAUUUACCUUUACAGCUAGGUUUUUCUACAGGUGUUAACCUAGUUGCUGUACCUACAGGUUAUGUUGAUACACCUAAUAAUACAGAUUUUUCCAGAGUUAGUGCUAAACCACCGCCUGGAGAUCAAUUUAAACACCUCAUACCACUUAUGUACAAAGGACUUCCUUGGAAUGUAGUGCGUAUAAAGAUUGUACAAAUGUUAAGUGACACACUUAAAAAUCUCUCUGACAGAGUCGUAUUUGUCUUAUGGGCACAUGGCUUUGAGUUGACAUCUAUGAAGUAUUUUGUGAAAAUAGGACCUGAGCGCACCUGUUGUCUAUGUGAUAGACGUGCCACAUGCUUUUCCACUGCUUCAGACACUUAUGCCUGUUGGCAUCAUUCUAUUGGAUUUGAUUACGUCUAUAAUCCGUUUAUGAUUGAUGUUCAACAAUGGGGUUUUACAGGUAACCUACAAAGCAACCAUGAUCUGUAUUGUCAAGUCCAUGGUAAUGCACAUGUAGCUAGUUGUGAUGCAAUCAUGACUAGGUGUCUAGCUGUCCACGAGUGCUUUGUUAAGCGUGUUGACUGGACUAUUGAAUAUCCUAUAAUUGGUGAUGAACUGAAGAUUAAUGCGGCUUGUAGAAAGGUUCAACACAUGGUUGUUAAAGCUGCAUUAUUAGCAGACAAAUUCCCAGUUCUUCACGACAUUGGUAACCCUAAAGCUAUUAAGUGUGUACCUCAAGCUGAUGUAGAAUGGAAGUUCUAUGAUGCACAGCCUUGUAGUGACAAAGCUUAUAAAAUAGAAGAAUUAUUCUAUUCUUAUGCCACACAUUCUGACAAAUUCACAGAUGGUGUAUGCCUAUUUUGGAAUUGCAAUGUCGAUAGAUAUCCUGCUAAUUCCAUUGUUUGUAGAUUUGACACUAGAGUGCUAUCUAACCUUAACUUGCCUGGUUGUGAUGGUGGCAGUUUGUAUGUAAAUAAACAUGCAUUCCACACACCAGCUUUUGAUAAAAGUGCUUUUGUUAAUUUAAAACAAUUACCAUUUUUCUAUUACUCUGACAGUCCAUGUGAGUCUCAUGGAAAACAAGUAGUGUCAGAUAUAGAUUAUGUACCACUAAAGUCUGCUACGUGUAUAACACGUUGCAAUUUAGGUGGUGCUGUCUGUAGACAUCAUGCUAAUGAGUACAGAUUGUAUCUCGAUGCUUAUAACAUGAUGAUCUCAGCUGGCUUUAGCUUGUGGGUUUACAAACAAUUUGAUACUUAUAACCUCUGGAACACUUUUACAAGACUUCAG
                                        
Uridylate-specific endoribonuclease (o NSP15) Evasione controlli del sistema immunitario
AGAGUUUAGAAAAUGUGGCUUUUAAUGUUGUAAAUAAGGGACACUUUGAUGGACAACAGGGUGAAGUACCAGUUUCUAUCAUUAAUAACACUGUUUACACAAAAGUUGAUGGUGUUGAUGUAGAAUUGUUUGAAAAUAAAACAACAUUACCUGUUAAUGUAGCAUUUGAGCUUUGGGCUAAGCGCAACAUUAAACCAGUACCAGAGGUGAAAAUACUCAAUAAUUUGGGUGUGGACAUUGCUGCUAAUACUGUGAUCUGGGACUACAAAAGAGAUGCUCCAGCACAUAUAUCUACUAUUGGUGUUUGUUCUAUGACUGACAUAGCCAAGAAACCAACUGAAACGAUUUGUGCACCACUCACUGUCUUUUUUGAUGGUAGAGUUGAUGGUCAAGUAGACUUAUUUAGAAAUGCCCGUAAUGGUGUUCUUAUUACAGAAGGUAGUGUUAAAGGUUUACAACCAUCUGUAGGUCCCAAACAAGCUAGUCUUAAUGGAGUCACAUUAAUUGGAGAAGCCGUAAAAACACAGUUCAAUUAUUAUAAGAAAGUUGAUGGUGUUGUCCAACAAUUACCUGAAACUUACUUUACUCAGAGUAGAAAUUUACAAGAAUUUAAACCCAGGAGUCAAAUGGAAAUUGAUUUCUUAGAAUUAGCUAUGGAUGAAUUCAUUGAACGGUAUAAAUUAGAAGGCUAUGCCUUCGAACAUAUCGUUUAUGGAGAUUUUAGUCAUAGUCAGUUAGGUGGUUUACAUCUACUGAUUGGACUAGCUAAACGUUUUAAGGAAUCACCUUUUGAAUUAGAAGAUUUUAUUCCUAUGGACAGUACAGUUAAAAACUAUUUCAUAACAGAUGCGCAAACAGGUUCAUCUAAGUGUGUGUGUUCUGUUAUUGAUUUAUUACUUGAUGAUUUUGUUGAAAUAAUAAAAUCCCAAGAUUUAUCUGUAGUUUCUAAGGUUGUCAAAGUGACUAUUGACUAUACAGAAAUUUCAUUUAUGCUUUGGUGUAAAGAUGGCCAUGUAGAAACAUUUUACCCAAAAUUACAA
                                        
2′-O-methyltransferase (o NSP16) Evasione controlli del sistema immunitario
UCUAGUCAAGCGUGGCAACCGGGUGUUGCUAUGCCUAAUCUUUACAAAAUGCAAAGAAUGCUAUUAGAAAAGUGUGACCUUCAAAAUUAUGGUGAUAGUGCAACAUUACCUAAAGGCAUAAUGAUGAAUGUCGCAAAAUAUACUCAACUGUGUCAAUAUUUAAACACAUUAACAUUAGCUGUACCCUAUAAUAUGAGAGUUAUACAUUUUGGUGCUGGUUCUGAUAAAGGAGUUGCACCAGGUACAGCUGUUUUAAGACAGUGGUUGCCUACGGGUACGCUGCUUGUCGAUUCAGAUCUUAAUGACUUUGUCUCUGAUGCAGAUUCAACUUUGAUUGGUGAUUGUGCAACUGUACAUACAGCUAAUAAAUGGGAUCUCAUUAUUAGUGAUAUGUACGACCCUAAGACUAAAAAUGUUACAAAAGAAAAUGACUCUAAAGAGGGUUUUUUCACUUACAUUUGUGGGUUUAUACAACAAAAGCUAGCUCUUGGAGGUUCCGUGGCUAUAAAGAUAACAGAACAUUCUUGGAAUGCUGAUCUUUAUAAGCUCAUGGGACACUUCGCAUGGUGGACAGCCUUUGUUACUAAUGUGAAUGCGUCAUCAUCUGAAGCAUUUUUAAUUGGAUGUAAUUAUCUUGGCAAACCACGCGAACAAAUAGAUGGUUAUGUCAUGCAUGCAAAUUACAUAUUUUGGAGGAAUACAAAUCCAAUUCAGUUGUCUUCCUAUUCUUUAUUUGACAUGAGUAAAUUUCCCCUUAAAUUAAGGGGUACUGCUGUUAUGUCUUUAAAAGAAGGUCAAAUCAAUGAUAUGAUUUUAUCUCUUCUUAGUAAAGGUAGACUUAUAAUUAGAGAAAACAACAGAGUUGUUAUUUCUAGUGAUGUUCUUGUUAACAACUAAACGAACA
                                        
Spike glycoprotein Cell binding and invasion
AUGUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACGUGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGACUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGGACCAAUGGUACUAAGAGGUUUGAUAACCCUGUCCUACCAUUUAAUGAUGGUGUUUAUUUUGCUUCCACUGAGAAGUCUAACAUAAUAAGAGGCUGGAUUUUUGGUACUACUUUAGAUUCGAAGACCCAGUCCCUACUUAUUGUUAAUAACGCUACUAAUGUUGUUAUUAAAGUCUGUGAAUUUCAAUUUUGUAAUGAUCCAUUUUUGGGUGUUUAUUACCACAAAAACAACAAAAGUUGGAUGGAAAGUGAGUUCAGAGUUUAUUCUAGUGCGAAUAAUUGCACUUUUGAAUAUGUCUCUCAGCCUUUUCUUAUGGACCUUGAAGGAAAACAGGGUAAUUUCAAAAAUCUUAGGGAAUUUGUGUUUAAGAAUAUUGAUGGUUAUUUUAAAAUAUAUUCUAAGCACACGCCUAUUAAUUUAGUGCGUGAUCUCCCUCAGGGUUUUUCGGCUUUAGAACCAUUGGUAGAUUUGCCAAUAGGUAUUAACAUCACUAGGUUUCAAACUUUACUUGCUUUACAUAGAAGUUAUUUGACUCCUGGUGAUUCUUCUUCAGGUUGGACAGCUGGUGCUGCAGCUUAUUAUGUGGGUUAUCUUCAACCUAGGACUUUUCUAUUAAAAUAUAAUGAAAAUGGAACCAUUACAGAUGCUGUAGACUGUGCACUUGACCCUCUCUCAGAAACAAAGUGUACGUUGAAAUCCUUCACUGUAGAAAAAGGAAUCUAUCAAACUUCUAACUUUAGAGUCCAACCAACAGAAUCUAUUGUUAGAUUUCCUAAUAUUACAAACUUGUGCCCUUUUGGUGAAGUUUUUAACGCCACCAGAUUUGCAUCUGUUUAUGCUUGGAACAGGAAGAGAAUCAGCAACUGUGUUGCUGAUUAUUCUGUCCUAUAUAAUUCCGCAUCAUUUUCCACUUUUAAGUGUUAUGGAGUGUCUCCUACUAAAUUAAAUGAUCUCUGCUUUACUAAUGUCUAUGCAGAUUCAUUUGUAAUUAGAGGUGAUGAAGUCAGACAAAUCGCUCCAGGGCAAACUGGAAAGAUUGCUGAUUAUAAUUAUAAAUUACCAGAUGAUUUUACAGGCUGCGUUAUAGCUUGGAAUUCUAACAAUCUUGAUUCUAAGGUUGGUGGUAAUUAUAAUUACCUGUAUAGAUUGUUUAGGAAGUCUAAUCUCAAACCUUUUGAGAGAGAUAUUUCAACUGAAAUCUAUCAGGCCGGUAGCACACCUUGUAAUGGUGUUGAAGGUUUUAAUUGUUACUUUCCUUUACAAUCAUAUGGUUUCCAACCCACUAAUGGUGUUGGUUACCAACCAUACAGAGUAGUAGUACUUUCUUUUGAACUUCUACAUGCACCAGCAACUGUUUGUGGACCUAAAAAGUCUACUAAUUUGGUUAAAAACAAAUGUGUCAAUUUCAACUUCAAUGGUUUAACAGGCACAGGUGUUCUUACUGAGUCUAACAAAAAGUUUCUGCCUUUCCAACAAUUUGGCAGAGACAUUGCUGACACUACUGAUGCUGUCCGUGAUCCACAGACACUUGAGAUUCUUGACAUUACACCAUGUUCUUUUGGUGGUGUCAGUGUUAUAACACCAGGAACAAAUACUUCUAACCAGGUUGCUGUUCUUUAUCAGGAUGUUAACUGCACAGAAGUCCCUGUUGCUAUUCAUGCAGAUCAACUUACUCCUACUUGGCGUGUUUAUUCUACAGGUUCUAAUGUUUUUCAAACACGUGCAGGCUGUUUAAUAGGGGCUGAACAUGUCAACAACUCAUAUGAGUGUGACAUACCCAUUGGUGCAGGUAUAUGCGCUAGUUAUCAGACUCAGACUAAUUCUCCUCGGCGGGCACGUAGUGUAGCUAGUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUCAGUUGCUUACUCUAAUAACUCUAUUGCCAUACCCACAAAUUUUACUAUUAGUGUUACCACAGAAAUUCUACCAGUGUCUAUGACCAAGACAUCAGUAGAUUGUACAAUGUACAUUUGUGGUGAUUCAACUGAAUGCAGCAAUCUUUUGUUGCAAUAUGGCAGUUUUUGUACACAAUUAAACCGUGCUUUAACUGGAAUAGCUGUUGAACAAGACAAAAACACCCAAGAAGUUUUUGCACAAGUCAAACAAAUUUACAAAACACCACCAAUUAAAGAUUUUGGUGGUUUUAAUUUUUCACAAAUAUUACCAGAUCCAUCAAAACCAAGCAAGAGGUCAUUUAUUGAAGAUCUACUUUUCAACAAAGUGACACUUGCAGAUGCUGGCUUCAUCAAACAAUAUGGUGAUUGCCUUGGUGAUAUUGCUGCUAGAGACCUCAUUUGUGCACAAAAGUUUAACGGCCUUACUGUUUUGCCACCUUUGCUCACAGAUGAAAUGAUUGCUCAAUACACUUCUGCACUGUUAGCGGGUACAAUCACUUCUGGUUGGACCUUUGGUGCAGGUGCUGCAUUACAAAUACCAUUUGCUAUGCAAAUGGCUUAUAGGUUUAAUGGUAUUGGAGUUACACAGAAUGUUCUCUAUGAGAACCAAAAAUUGAUUGCCAACCAAUUUAAUAGUGCUAUUGGCAAAAUUCAAGACUCACUUUCUUCCACAGCAAGUGCACUUGGAAAACUUCAAGAUGUGGUCAACCAAAAUGCACAAGCUUUAAACACGCUUGUUAAACAACUUAGCUCCAAUUUUGGUGCAAUUUCAAGUGUUUUAAAUGAUAUCCUUUCACGUCUUGACAAAGUUGAGGCUGAAGUGCAAAUUGAUAGGUUGAUCACAGGCAGACUUCAAAGUUUGCAGACAUAUGUGACUCAACAAUUAAUUAGAGCUGCAGAAAUCAGAGCUUCUGCUAAUCUUGCUGCUACUAAAAUGUCAGAGUGUGUACUUGGACAAUCAAAAAGAGUUGAUUUUUGUGGAAAGGGCUAUCAUCUUAUGUCCUUCCCUCAGUCAGCACCUCAUGGUGUAGUCUUCUUGCAUGUGACUUAUGUCCCUGCACAAGAAAAGAACUUCACAACUGCUCCUGCCAUUUGUCAUGAUGGAAAAGCACACUUUCCUCGUGAAGGUGUCUUUGUUUCAAAUGGCACACACUGGUUUGUAACACAAAGGAAUUUUUAUGAACCACAAAUCAUUACUACAGACAACACAUUUGUGUCUGGUAACUGUGAUGUUGUAAUAGGAAUUGUCAACAACACAGUUUAUGAUCCUUUGCAACCUGAAUUAGACUCAUUCAAGGAGGAGUUAGAUAAAUAUUUUAAGAAUCAUACAUCACCAGAUGUUGAUUUAGGUGACAUCUCUGGCAUUAAUGCUUCAGUUGUAAACAUUCAAAAAGAAAUUGACCGCCUCAAUGAGGUUGCCAAGAAUUUAAAUGAAUCUCUCAUCGAUCUCCAAGAACUUGGAAAGUAUGAGCAGUAUAUAAAAUGGCCAUGGUACAUUUGGCUAGGUUUUAUAGCUGGCUUGAUUGCCAUAGUAAUGGUGACAAUUAUGCUUUGCUGUAUGACCAGUUGCUGUAGUUGUCUCAAGGGCUGUUGUUCUUGUGGAUCCUGCUGCAAAUUUGAUGAAGACGACUCUGAGCCAGUGCUCAAAGGAGUCAAAUUACAUUACACAUAAACGAACUU
                                        
Protein 3a (o ORF3a)
AUGGAUUUGUUUAUGAGAAUCUUCACAAUUGGAACUGUAACUUUGAAGCAAGGUGAAAUCAAGGAUGCUACUCCUUCAGAUUUUGUUCGCGCUACUGCAACGAUACCGAUACAAGCCUCACUCCCUUUCGGAUGGCUUAUUGUUGGCGUUGCACUUCUUGCUGUUUUUCAGAGCGCUUCCAAAAUCAUAACCCUCAAAAAGAGAUGGCAACUAGCACUCUCCAAGGGUGUUCACUUUGUUUGCAACUUGCUGUUGUUGUUUGUAACAGUUUACUCACACCUUUUGCUCGUUGCUGCUGGCCUUGAAGCCCCUUUUCUCUAUCUUUAUGCUUUAGUCUACUUCUUGCAGAGUAUAAACUUUGUAAGAAUAAUAAUGAGGCUUUGGCUUUGCUGGAAAUGCCGUUCCAAAAACCCAUUACUUUAUGAUGCCAACUAUUUUCUUUGCUGGCAUACUAAUUGUUACGACUAUUGUAUACCUUACAAUAGUGUAACUUCUUCAAUUGUCAUUACUUCAGGUGAUGGCACAACAAGUCCUAUUUCUGAACAUGACUACCAGAUUGGUGGUUAUACUGAAAAAUGGGAAUCUGGAGUAAAAGACUGUGUUGUAUUACACAGUUACUUCACUUCAGACUAUUACCAGCUGUACUCAACUCAAUUGAGUACAGACACUGGUGUUGAACAUGUUACCUUCUUCAUCUACAAUAAAAUUGUUGAUGAGCCUGAAGAACAUGUCCAAAUUCACACAAUCGACGGUUCAUCCGGAGUUGUUAAUCCAGUAAUGGAACCAAUUUAUGAUGAACCGACGACGACUACUAGCGUGCCUUUGUAAGCACAAGCUGAUGAGUACGAACUU
                                        
E Avvolgimento strutturale, assemblamento e patogenesi
AUGUACUCAUUCGUUUCGGAAGAGACAGGUACGUUAAUAGUUAAUAGCGUACUUCUUUUUCUUGCUUUCGUGGUAUUCUUGCUAGUUACACUAGCCAUCCUUACUGCGCUUCGAUUGUGUGCGUACUGCUGCAAUAUUGUUAACGUGAGUCUUGUAAAACCUUCUUUUUACGUUUACUCUCGUGUUAAAAAUCUGAAUUCUUCUAGAGUUCCUGAUCUUCUGGUCUAAACGAACUAAAUAUUAUAUUAGUUUUUCUGUUUGGAACUUUAAUUUUAGCC
                                        
Membrane protein (or M) Rivestimento esterno
AUGGCAGAUUCCAACGGUACUAUUACCGUUGAAGAGCUUAAAAAGCUCCUUGAACAAUGGAACCUAGUAAUAGGUUUCCUAUUCCUUACAUGGAUUUGUCUUCUACAAUUUGCCUAUGCCAACAGGAAUAGGUUUUUGUAUAUAAUUAAGUUAAUUUUCCUCUGGCUGUUAUGGCCAGUAACUUUAGCUUGUUUUGUGCUUGCUGCUGUUUACAGAAUAAAUUGGAUCACCGGUGGAAUUGCUAUCGCAAUGGCUUGUCUUGUAGGCUUGAUGUGGCUCAGCUACUUCAUUGCUUCUUUCAGACUGUUUGCGCGUACGCGUUCCAUGUGGUCAUUCAAUCCAGAAACUAACAUUCUUCUCAACGUGCCACUCCAUGGCACUAUUCUGACCAGACCGCUUCUAGAAAGUGAACUCGUAAUCGGAGCUGUGAUCCUUCGUGGACAUCUUCGUAUUGCUGGACACCAUCUAGGACGCUGUGACAUCAAGGACCUGCCUAAAGAAAUCACUGUUGCUACAUCACGAACGCUUUCUUAUUACAAAUUGGGAGCUUCGCAGCGUGUAGCAGGUGACUCAGGUUUUGCUGCAUACAGUCGCUACAGGAUUGGCAACUAUAAAUUAAACACAGACCAUUCCAGUAGCAGUGACAAUAUUGCUUUGCUUGUACAGUAAGUGACAACAG
                                        
ORF6 Inibizione dei segnali di attivazione del sistema immunitario
AUGUUUCAUCUCGUUGACUUUCAGGUUACUAUAGCAGAGAUAUUACUAAUUAUUAUGAGGACUUUUAAAGUUUCCAUUUGGAAUCUUGAUUACAUCAUAAACCUCAUAAUUAAAAAUUUAUCUAAGUCACUAACUGAGAAUAAAUAUUCUCAAUUAGAUGAAGAGCAACCAAUGGAGAUUGAUUAAACGAAC
                                        
7a Rilascio del virus dalla cellula infettata e attivazione del segnale di autodistruzione della stessa
AUGAAAAUUAUUCUUUUCUUGGCACUGAUAACACUCGCUACUUGUGAGCUUUAUCACUACCAAGAGUGUGUUAGAGGUACAACAGUACUUUUAAAAGAACCUUGCUCUUCUGGAACAUACGAGGGCAAUUCACCAUUUCAUCCUCUAGCUGAUAACAAAUUUGCACUGACUUGCUUUAGCACUCAAUUUGCUUUUGCUUGUCCUGACGGCGUAAAACACGUCUAUCAGUUACGUGCCAGAUCAGUUUCACCUAAACUGUUCAUCAGACAAGAGGAAGUUCAAGAACUUUACUCUCCAAUUUUUCUUAUUGUUGCGGCAAUAGUGUUUAUAACACUUUGCUUCACACUCAAAAGAAAGACAGAAUGAUUGAACUUUCAUUAAUUGACUUCUAUUUGUGCUUUUUAGCCUUUCUGCUAUUCCUUGUUUUAAUUAUGCUUAUUAUCUUUUGGUUCUCACUUGAACUGCAAGAUCAUAAUGAAACUUGUCACGCCUAAACGAAC
                                        
ORF8 Sconosciuta
AUGAAAUUUCUUGUUUUCUUAGGAAUCAUCACAACUGUAGCUGCAUUUCACCAAGAAUGUAGUUUACAGUCAUGUACUCAACAUCAACCAUAUGUAGUUGAUGACCCGUGUCCUAUUCACUUCUAUUCUAAAUGGUAUAUUAGAGUAGGAGCUAGAAAAUCAGCACCUUUAAUUGAAUUGUGCGUGGAUGAGGCUGGUUCUAAAUCACCCAUUCAGUACAUCGAUAUCGGUAAUUAUACAGUUUCCUGUUUACCUUUUACAAUUAAUUGCCAGGAACCUAAAUUGGGUAGUCUUGUAGUGCGUUGUUCGUUCUAUGAAGACUUUUUAGAGUAUCAUGACGUUCGUGUUGUUUUAGAUUUCAUCUAAACGAACAAACUAAA
                                        
Nucleoprotein (or N) Protezione del materiale genetico
AUGUCUGAUAAUGGACCCCAAAAUCAGCGAAAUGCACCCCGCAUUACGUUUGGUGGACCCUCAGAUUCAACUGGCAGUAACCAGAAUGGAGAACGCAGUGGGGCGCGAUCAAAACAACGUCGGCCCCAAGGUUUACCCAAUAAUACUGCGUCUUGGUUCACCGCUCUCACUCAACAUGGCAAGGAAGACCUUAAAUUCCCUCGAGGACAAGGCGUUCCAAUUAACACCAAUAGCAGUCCAGAUGACCAAAUUGGCUACUACCGAAGAGCUACCAGACGAAUUCGUGGUGGUGACGGUAAAAUGAAAGAUCUCAGUCCAAGAUGGUAUUUCUACUACCUAGGAACUGGGCCAGAAGCUGGACUUCCCUAUGGUGCUAACAAAGACGGCAUCAUAUGGGUUGCAACUGAGGGAGCCUUGAAUACACCAAAAGAUCACAUUGGCACCCGCAAUCCUGCUAACAAUGCUGCAAUCGUGCUACAACUUCCUCAAGGAACAACAUUGCCAAAAGGCUUCUACGCAGAAGGGAGCAGAGGCGGCAGUCAAGCCUCUUCUCGUUCCUCAUCACGUAGUCGCAACAGUUCAAGAAAUUCAACUCCAGGCAGCAGUAGGGGAACUUCUCCUGCUAGAAUGGCUGGCAAUGGCGGUGAUGCUGCUCUUGCUUUGCUGCUGCUUGACAGAUUGAACCAGCUUGAGAGCAAAAUGUCUGGUAAAGGCCAACAACAACAAGGCCAAACUGUCACUAAGAAAUCUGCUGCUGAGGCUUCUAAGAAGCCUCGGCAAAAACGUACUGCCACUAAAGCAUACAAUGUAACACAAGCUUUCGGCAGACGUGGUCCAGAACAAACCCAAGGAAAUUUUGGGGACCAGGAACUAAUCAGACAAGGAACUGAUUACAAACAUUGGCCGCAAAUUGCACAAUUUGCCCCCAGCGCUUCAGCGUUCUUCGGAAUGUCGCGCAUUGGCAUGGAAGUCACACCUUCGGGAACGUGGUUGACCUACACAGGUGCCAUCAAAUUGGAUGACAAAGAUCCAAAUUUCAAAGAUCAAGUCAUUUUGCUGAAUAAGCAUAUUGACGCAUACAAAACAUUCCCACCAACAGAGCCUAAAAAGGACAAAAAGAAGAAGGCUGAUGAAACUCAAGCCUUACCGCAGAGACAGAAGAAACAGCAAACUGUGACUCUUCUUCCUGCUGCAGAUUUGGAUGAUUUCUCCAAACAAUUGCAACAAUCCAUGAGCAGUGCUGACUCAACUCAGGCCUAAACUCAUGCAGACCACACAAGGCAG
                                        
ORF10 Sconosciuta
AUGGGCUAUAUAAACGUUUUCGCUUUUCCGUUUACGAUAUAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUUUAAUCUCACAUAG
                                        
Ogni proteina può essere immaginata come una funzione (sotto-routine) del codice sorgente del virus, in pseudo-codice:
MODULE protein
...
                            
Da un punto di vista puramente informatico, questo virus (così come altri organismi) è un capolavoro della programmazione: in 7.3 KB è capace di fare breccia dentro una cellula rimanendo nascosto al sistema immunitario, innestare il suo codice genetico, replicare le sue parti, verificare che la copia non abbia errori e infine sabotare la cellula ospite.

Per chi di voi ricorda la diffusione del virus informatico 'I Love You', apparso nel 2000 infettando oltre 10 milioni di computers nel mondo, ecco un confronto interessante: il suo codice sorgente era di 10.1 KB, ben 3 KB in più e con l'importante differenza che il virus biologico si adatta all'ambiente circostante, talvolta mutando e portando avanti le varianti più resistenti dal punto di vista evolutivo.

La recente mutazione del SARS-CoV-2

Il 20 Dicembre 2020 l'ECDC (l'organismo Europeo per il controllo delle malattie) ha annunciato l'osservazione di una nuova variante del virus. Che cosa è una variante?

Come detto in precedenza, il virus può mutare. Queste mutazioni sono spesso il frutto di un errore di trascrizione del codice sorgente: talvolta questi errori non alterano il funzionamento del virus, talvolta ne alterano la funzione di alcune proteine. Se il cambiamento si riflette in un vantaggio evolutivo, il virus mutato avrà un'alta probabilità di replicarsi, altrimenti scomparirà abbastanza velocemente.

Vale la pena spendere qualche riga in più su questo concetto. In virtù del fatto che un organismo è una sorta di macchina biologica straordinaria ma pur sempre imperfetta, è plausibile pensare che nel passaggio da una generazione alla successiva cerchi di migliorare le sue possibilità di sopravvivenza: questo processo è modellizzato dai paesaggi di fitness (si veda figura sotto).

Illustrazione di un tipico "paesaggio di fitness": in biologia evoluzionistica gli assi X e Y indicano informazioni genetiche, mentre l'asse Z quantifica il successo evolutivo di un organismo per una data combinazione di informazioni genetiche. Più alto è il fitness, più è grande la capacità dell'organismo di adattarsi all'ambiente che lo circonda e quindi a sopravvivere. Le traiettorie su un paesaggio di fitness codificano i tentativi evolutivi, di generazione in generazione, per migliorare il proprio fitness.
Dal punto di vista informatico, l'esplorazione del paesaggi odi fitness è assimilabile all'esplorazione di uno spazio di possibilità da parte di un algoritmo di ottimizzazione per la realizzazione efficiente di un determinato task, dove il ruolo del fitness è giocato dalla funzione di costo o di guadagno. Immagine: Wikipedia


La nuova variante, conosciuta come VOC 202012/01 o B.1.1.7, presenta numerose piccole mutazioni il cui risultato sembra essere una maggiore trasmissibilità, fino al 70%. Stime recentissime indicano un valore pari al 56%, con una banda di confidenza tra il 50% e il 74% (Fonte: CCMID).

In fondo, dunque, la variante è nient'altro che una sorta di fork del codice sorgente, molto simile all'originale ma con alcune differenze che lo sviluppatore principale (in questo caso la Natura) può accettare o meno. A queste differenze viene assegnato un nome, per identificarle facilmente. Le più note sono:

  • D614G: (si legge: mutazione nel 614-esimo amminoacido tra D e G), scoperta nei mesi scorsi, permette al virus di migliorare la sua capacità di replicazione nei tessuti polmonari ed aumenta la carica virale nel tratto respiratorio superiore (Fonti: Nature 2020, Science 2020)
  • N501Y: permette al virus di connettersi più stabilmente al recettore umano noto come ACE2 (il "punto debole" della cellula che viene sfruttato per fare breccia)
  • Cancellazione 69/70: cambiamento spontaneo che porta ad un'alterazione nella forma della proteina Spike (quella usata per "agganciare" la cellula umana)
  • P681H: cambiamento spontaneo
  • Codone di stop ORF8 (Q27stop): questa mutazione avviene nel modulo (proteina..) ORF8, la cui funzione è sconosciuta


Illustrazione della mutazione D614G. Fonte: Scripps Research and NY Times


Più avanti vedremo in dettaglio come funziona uno dei vaccini in circolazione, ma per concludere questa sezione possiamo dire che al momento non c'è evidenza sperimentale che indichi una ridotta efficacia del vaccino contro questa nuova variante, nè che causi un decorso più aggressivo del COVID-19 (fortunatamente). L'unica evidenza suggerisce che il virus "patchato" si trasmette più facilmente e sembra essere più efficiente dell'originale nella trasmissione tra bambini ed adolescenti (Fonte: BMJ 2020).

Il vaccino contro SARS-CoV-2

Diversi gruppi di ricerca nel mondo hanno avviato lo sviluppo di un potenziale vaccino contro il virus. In particolare, focalizziamoci su quello prodotto da BioNTech/Pfizer, che si basa sulla creazione di un ingegnoso mRNA (l'RNA messaggero) che esegue un vero e proprio "hacking" biologico, per permettere alle nostre cellule di imparare a riconoscere il SARS-CoV-2 e quindi bypassare i moduli di ofuscamento utilizzati dal virus per produrre le proteine necessarie per lasciarlo passare inosservato al nostro sistema immunitario.

Come per il virus, anche il vaccino può essere schematizzato in termine di codice sorgente che svolge il ruolo vero e proprio di "antivirus". Il sorgente di 4284 caratteri (1.04 KB) è mostrato integralmente qui di seguito:
GAGAAΨAAAC ΨAGΨAΨΨCΨΨ CΨGGΨCCCCA CAGACΨCAGA GAGAACCCGC   50
CACCAΨGΨΨC GΨGΨΨCCΨGG ΨGCΨGCΨGCC ΨCΨGGΨGΨCC AGCCAGΨGΨG  100
ΨGAACCΨGAC CACCAGAACA CAGCΨGCCΨC CAGCCΨACAC CAACAGCΨΨΨ  150
ACCAGAGGCG ΨGΨACΨACCC CGACAAGGΨG ΨΨCAGAΨCCA GCGΨGCΨGCA  200
CΨCΨACCCAG GACCΨGΨΨCC ΨGCCΨΨΨCΨΨ CAGCAACGΨG ACCΨGGΨΨCC  250
ACGCCAΨCCA CGΨGΨCCGGC ACCAAΨGGCA CCAAGAGAΨΨ CGACAACCCC  300
GΨGCΨGCCCΨ ΨCAACGACGG GGΨGΨACΨΨΨ GCCAGCACCG AGAAGΨCCAA  350
CAΨCAΨCAGA GGCΨGGAΨCΨ ΨCGGCACCAC ACΨGGACAGC AAGACCCAGA  400
GCCΨGCΨGAΨ CGΨGAACAAC GCCACCAACG ΨGGΨCAΨCAA AGΨGΨGCGAG  450
ΨΨCCAGΨΨCΨ GCAACGACCC CΨΨCCΨGGGC GΨCΨACΨACC ACAAGAACAA  500
CAAGAGCΨGG AΨGGAAAGCG AGΨΨCCGGGΨ GΨACAGCAGC GCCAACAACΨ  550
GCACCΨΨCGA GΨACGΨGΨCC CAGCCΨΨΨCC ΨGAΨGGACCΨ GGAAGGCAAG  600
CAGGGCAACΨ ΨCAAGAACCΨ GCGCGAGΨΨC GΨGΨΨΨAAGA ACAΨCGACGG  650
CΨACΨΨCAAG AΨCΨACAGCA AGCACACCCC ΨAΨCAACCΨC GΨGCGGGAΨC  700
ΨGCCΨCAGGG CΨΨCΨCΨGCΨ CΨGGAACCCC ΨGGΨGGAΨCΨ GCCCAΨCGGC  750
AΨCAACAΨCA CCCGGΨΨΨCA GACACΨGCΨG GCCCΨGCACA GAAGCΨACCΨ  800
GACACCΨGGC GAΨAGCAGCA GCGGAΨGGAC AGCΨGGΨGCC GCCGCΨΨACΨ  850
AΨGΨGGGCΨA CCΨGCAGCCΨ AGAACCΨΨCC ΨGCΨGAAGΨA CAACGAGAAC  900
GGCACCAΨCA CCGACGCCGΨ GGAΨΨGΨGCΨ CΨGGAΨCCΨC ΨGAGCGAGAC  950
AAAGΨGCACC CΨGAAGΨCCΨ ΨCACCGΨGGA AAAGGGCAΨC ΨACCAGACCA 1000
GCAACΨΨCCG GGΨGCAGCCC ACCGAAΨCCA ΨCGΨGCGGΨΨ CCCCAAΨAΨC 1050
ACCAAΨCΨGΨ GCCCCΨΨCGG CGAGGΨGΨΨC AAΨGCCACCA GAΨΨCGCCΨC 1100
ΨGΨGΨACGCC ΨGGAACCGGA AGCGGAΨCAG CAAΨΨGCGΨG GCCGACΨACΨ 1150
CCGΨGCΨGΨA CAACΨCCGCC AGCΨΨCAGCA CCΨΨCAAGΨG CΨACGGCGΨG 1200
ΨCCCCΨACCA AGCΨGAACGA CCΨGΨGCΨΨC ACAAACGΨGΨ ACGCCGACAG 1250
CΨΨCGΨGAΨC CGGGGAGAΨG AAGΨGCGGCA GAΨΨGCCCCΨ GGACAGACAG 1300
GCAAGAΨCGC CGACΨACAAC ΨACAAGCΨGC CCGACGACΨΨ CACCGGCΨGΨ 1350
GΨGAΨΨGCCΨ GGAACAGCAA CAACCΨGGAC ΨCCAAAGΨCG GCGGCAACΨA 1400
CAAΨΨACCΨG ΨACCGGCΨGΨ ΨCCGGAAGΨC CAAΨCΨGAAG CCCΨΨCGAGC 1450
GGGACAΨCΨC CACCGAGAΨC ΨAΨCAGGCCG GCAGCACCCC ΨΨGΨAACGGC 1500
GΨGGAAGGCΨ ΨCAACΨGCΨA CΨΨCCCACΨG CAGΨCCΨACG GCΨΨΨCAGCC 1550
CACAAAΨGGC GΨGGGCΨAΨC AGCCCΨACAG AGΨGGΨGGΨG CΨGAGCΨΨCG 1600
AACΨGCΨGCA ΨGCCCCΨGCC ACAGΨGΨGCG GCCCΨAAGAA AAGCACCAAΨ 1650
CΨCGΨGAAGA ACAAAΨGCGΨ GAACΨΨCAAC ΨΨCAACGGCC ΨGACCGGCAC 1700
CGGCGΨGCΨG ACAGAGAGCA ACAAGAAGΨΨ CCΨGCCAΨΨC CAGCAGΨΨΨG 1750
GCCGGGAΨAΨ CGCCGAΨACC ACAGACGCCG ΨΨAGAGAΨCC CCAGACACΨG 1800
GAAAΨCCΨGG ACAΨCACCCC ΨΨGCAGCΨΨC GGCGGAGΨGΨ CΨGΨGAΨCAC 1850
CCCΨGGCACC AACACCAGCA AΨCAGGΨGGC AGΨGCΨGΨAC CAGGACGΨGA 1900
ACΨGΨACCGA AGΨGCCCGΨG GCCAΨΨCACG CCGAΨCAGCΨ GACACCΨACA 1950
ΨGGCGGGΨGΨ ACΨCCACCGG CAGCAAΨGΨG ΨΨΨCAGACCA GAGCCGGCΨG 2000
ΨCΨGAΨCGGA GCCGAGCACG ΨGAACAAΨAG CΨACGAGΨGC GACAΨCCCCA 2050
ΨCGGCGCΨGG AAΨCΨGCGCC AGCΨACCAGA CACAGACAAA CAGCCCΨCGG 2100
AGAGCCAGAA GCGΨGGCCAG CCAGAGCAΨC AΨΨGCCΨACA CAAΨGΨCΨCΨ 2150
GGGCGCCGAG AACAGCGΨGG CCΨACΨCCAA CAACΨCΨAΨC GCΨAΨCCCCA 2200
CCAACΨΨCAC CAΨCAGCGΨG ACCACAGAGA ΨCCΨGCCΨGΨ GΨCCAΨGACC 2250
AAGACCAGCG ΨGGACΨGCAC CAΨGΨACAΨC ΨGCGGCGAΨΨ CCACCGAGΨG 2300
CΨCCAACCΨG CΨGCΨGCAGΨ ACGGCAGCΨΨ CΨGCACCCAG CΨGAAΨAGAG 2350
CCCΨGACAGG GAΨCGCCGΨG GAACAGGACA AGAACACCCA AGAGGΨGΨΨC 2400
GCCCAAGΨGA AGCAGAΨCΨA CAAGACCCCΨ CCΨAΨCAAGG ACΨΨCGGCGG 2450
CΨΨCAAΨΨΨC AGCCAGAΨΨC ΨGCCCGAΨCC ΨAGCAAGCCC AGCAAGCGGA 2500
GCΨΨCAΨCGA GGACCΨGCΨG ΨΨCAACAAAG ΨGACACΨGGC CGACGCCGGC 2550
ΨΨCAΨCAAGC AGΨAΨGGCGA ΨΨGΨCΨGGGC GACAΨΨGCCG CCAGGGAΨCΨ 2600
GAΨΨΨGCGCC CAGAAGΨΨΨA ACGGACΨGAC AGΨGCΨGCCΨ CCΨCΨGCΨGA 2650
CCGAΨGAGAΨ GAΨCGCCCAG ΨACACAΨCΨG CCCΨGCΨGGC CGGCACAAΨC 2700
ACAAGCGGCΨ GGACAΨΨΨGG AGCAGGCGCC GCΨCΨGCAGA ΨCCCCΨΨΨGC 2750
ΨAΨGCAGAΨG GCCΨACCGGΨ ΨCAACGGCAΨ CGGAGΨGACC CAGAAΨGΨGC 2800
ΨGΨACGAGAA CCAGAAGCΨG AΨCGCCAACC AGΨΨCAACAG CGCCAΨCGGC 2850
AAGAΨCCAGG ACAGCCΨGAG CAGCACAGCA AGCGCCCΨGG GAAAGCΨGCA 2900
GGACGΨGGΨC AACCAGAAΨG CCCAGGCACΨ GAACACCCΨG GΨCAAGCAGC 2950
ΨGΨCCΨCCAA CΨΨCGGCGCC AΨCAGCΨCΨG ΨGCΨGAACGA ΨAΨCCΨGAGC 3000
AGACΨGGACC CΨCCΨGAGGC CGAGGΨGCAG AΨCGACAGAC ΨGAΨCACAGG 3050
CAGACΨGCAG AGCCΨCCAGA CAΨACGΨGAC CCAGCAGCΨG AΨCAGAGCCG 3100
CCGAGAΨΨAG AGCCΨCΨGCC AAΨCΨGGCCG CCACCAAGAΨ GΨCΨGAGΨGΨ 3150
GΨGCΨGGGCC AGAGCAAGAG AGΨGGACΨΨΨ ΨGCGGCAAGG GCΨACCACCΨ 3200
GAΨGAGCΨΨC CCΨCAGΨCΨG CCCCΨCACGG CGΨGGΨGΨΨΨ CΨGCACGΨGA 3250
CAΨAΨGΨGCC CGCΨCAAGAG AAGAAΨΨΨCA CCACCGCΨCC AGCCAΨCΨGC 3300
CACGACGGCA AAGCCCACΨΨ ΨCCΨAGAGAA GGCGΨGΨΨCG ΨGΨCCAACGG 3350
CACCCAΨΨGG ΨΨCGΨGACAC AGCGGAACΨΨ CΨACGAGCCC CAGAΨCAΨCA 3400
CCACCGACAA CACCΨΨCGΨG ΨCΨGGCAACΨ GCGACGΨCGΨ GAΨCGGCAΨΨ 3450
GΨGAACAAΨA CCGΨGΨACGA CCCΨCΨGCAG CCCGAGCΨGG ACAGCΨΨCAA 3500
AGAGGAACΨG GACAAGΨACΨ ΨΨAAGAACCA CACAAGCCCC GACGΨGGACC 3550
ΨGGGCGAΨAΨ CAGCGGAAΨC AAΨGCCAGCG ΨCGΨGAACAΨ CCAGAAAGAG 3600
AΨCGACCGGC ΨGAACGAGGΨ GGCCAAGAAΨ CΨGAACGAGA GCCΨGAΨCGA 3650
CCΨGCAAGAA CΨGGGGAAGΨ ACGAGCAGΨA CAΨCAAGΨGG CCCΨGGΨACA 3700
ΨCΨGGCΨGGG CΨΨΨAΨCGCC GGACΨGAΨΨG CCAΨCGΨGAΨ GGΨCACAAΨC 3750
AΨGCΨGΨGΨΨ GCAΨGACCAG CΨGCΨGΨAGC ΨGCCΨGAAGG GCΨGΨΨGΨAG 3800
CΨGΨGGCAGC ΨGCΨGCAAGΨ ΨCGACGAGGA CGAΨΨCΨGAG CCCGΨGCΨGA 3850
AGGGCGΨGAA ACΨGCACΨAC ACAΨGAΨGAC ΨCGAGCΨGGΨ ACΨGCAΨGCA 3900
CGCAAΨGCΨA GCΨGCCCCΨΨ ΨCCCGΨCCΨG GGΨACCCCGA GΨCΨCCCCCG 3950
ACCΨCGGGΨC CCAGGΨAΨGC ΨCCCACCΨCC ACCΨGCCCCA CΨCACCACCΨ 4000
CΨGCΨAGΨΨC CAGACACCΨC CCAAGCACGC AGCAAΨGCAG CΨCAAAACGC 4050
ΨΨAGCCΨAGC CACACCCCCA CGGGAAACAG CAGΨGAΨΨAA CCΨΨΨAGCAA 4100
ΨAAACGAAAG ΨΨΨAACΨAAG CΨAΨACΨAAC CCCAGGGΨΨG GΨCAAΨΨΨCG 4150
ΨGCCAGCCAC ACCCΨGGAGC ΨAGCAAAAAA AAAAAAAAAA AAAAAAAAAA 4200
AAAAGCAΨAΨ GACΨAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA 4250
AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAA                  4284

                            
Intera sequenza di caratteri del vaccino mRNA BNT162b2 contro COVID-19. Fonte: Organizzazione Mondiale della Sanità

Un'analisi approfondita di questo codice è stata effettuata da Bert Hubert, con un post dal titolo "Reverse Engineering the source code of the BioNTech/Pfizer SARS-CoV-2 Vaccine" nel suo blog, di cui esiste anche una versione tradotta in italiano. Poichè la traduzione è ottima, riporto qui integralmente alcune parti di quel post, (colorando in grigio le parti non direttamente scritte da me):

L'idea dietro il vaccino è di insegnare al nostro sistema immunitario come combattere con un patogeno, senza però ammalarci veramente. Storicamente questo è stato fatto iniettando un virus indebolito o neutralizzato (attenuato), più un adiuvante che spingesse il nostro sistema immunitario all'azione. Questa era una tecnica decisamente analogica, e implicava miliardi di uova (o di insetti). Richiedeva anche un sacco di fortuna e molto di tempo. A volte, veniva usato anche un virus diverso (non collegato).

Un vaccino a mRNA ottiene lo stesso risultato ("informare il nostro sistema immunitario") ma con una precisione laser. E intendo questo in entrambi i sensi: molto preciso ma anche molto potente.

Ed ecco qui come funziona. L'iniezione contiene materiale genetico volatile, che descrive la famosa proteina "Spike" del SARS-CoV-2. Attraverso ingegnosi metodi chimici il vaccino riesce a introdurre questo materiale genetico all'interno di alcune delle nostre cellule.

Queste perciò iniziano obbedienti a produrre proteine Spike SARS-CoV-2 in quantità grandi abbastanza da fare scattare in azione il nostro sistema immunitario. Trovandosi davanti a queste proteine Spike e (importante) a segni che le cellule sono state invase, il sistema immunitario sviluppa una risposta massiccia contro diversi aspetti delle proteine Spike e contro il loro processo produttivo.

E questo è ciò che ci dà un vaccino efficiente al 95%.

[Tornando al sorgente del vaccino] incontriamo la prima sorpresa. I normali caratteri del RNA sono A, C, G e U. U è la molecola che nel DNA corrisponde a "T". Ma qui troviamo un Ψ: che succede? Questo è uno dei punti estremamente ingegnosi di questo vaccino. Il nostro corpo utilizza un potente antivirus (l'originale!). Per questo motivo, le cellule sono estremamente poco amichevoli verso del RNA estraneo, e si impegnano molto per distruggerlo prima che riesca a fare qualsiasi cosa. Questo è un po' un problema, per il nostro vaccino, che deve infiltrarsi oltrepassando il sistema immunitario. Ma dopo molti anni di esperimenti si è scoperto che se la U nell'RNA viene sostituita con una molecola diversa, il nostro sistema immunitario perde interesse. Completamente. E così nel vaccino BioNTech/Pfizer, ogni molecola di uracile U è stata sostituita con una molecola di 1-metil-3'-pseudouridina, indicata con Ψ. E la parte ingegnosa è che anche se questa Ψ sostituita calma il nostro sistema immunitario, le parti chiave della cellula la continuano a considerare come una normale U. Anche in sicurezza informatica conosciamo bene questo trucco: a volte è possibile inviare una versione leggermente alterata di un messaggio, che confonde i firewall e le soluzioni di sicurezza, ma che è lo stesso accettata come valida dai server che vi stanno dietro, e che in questo modo possono venire hackerati. Oggi raccogliamo i benefici di una ricerca scientifica fondamentale svoltasi negli ultimi anni. Gli scopritori della tecnica Ψ hanno dovuto combattere, per ottenere i fondi per il loro progetto, e poi per farlo accettare. Dovremmo tutti essere loro molto grati, e credo che a tempo debito arriveranno anche i premi Nobel.

Il peptide di segnalazione della glicoproteina S

Come si è detto, lo scopo del vaccino è indurre la cellula a produrre grossi quantitativi di proteina Spike del SARS-CoV-2. Fino a questo punto, abbiamo incontrato solo metadati e "convenzioni di chiamata" nel codice sorgente del vaccino. Ma ora entriamo nel territorio della vera proteina virale.

Abbiamo però un ultimo strato di metadati da esaminare. Quando il ribosoma (come mostrato dalla splendida animazione precedente) ha prodotto una proteina, quella proteina deve poi andare da qualche parte. Questo è codificato con la "sequenza di avvio estesa del peptide di segnalazione della glicoproteina S".

Per vedere questa cosa, immaginiamo che all'inizio della proteina ci sia una etichetta di qualche tipo, codificata come parte della proteina medesima. In questo caso specifico, il peptide di segnalazione dice che questa proteina deve uscire dalla cellula attraverso "il reticolo endoplasmatico". Perfino il gergo di Star Trek non arriva a tanto!

Il "peptide di segnalazione" non è molto lungo: però, quando guardiamo il codice troviamo delle differenze fra il RNA del virus e quello del vaccino.

(Notate che per semplificare la comparazione, ho sostituito le Ψ modificate con ordinarie U del RNA):
           3   3   3   3   3   3   3   3   3   3   3   3   3   3   3   3
Virus:   AUG UUU GUU UUU CUU GUU UUA UUG CCA CUA GUC UCU AGU CAG UGU GUU
Vaccine: AUG UUC GUG UUC CUG GUG CUG CUG CCU CUG GUG UCC AGC CAG UGU GUU
               !   !   !   !   ! ! ! !     !   !   !   !   !            

Che cosa sta succedendo, qui? Non ho diviso il RNA in gruppi di tre lettere per caso. Tre lettere di RNA formano un codone. E ogni codone codifica per uno specifico aminoacido. Il peptide di segnalazione nel vaccino consiste esattamente nei medesimi aminoacidi che sono codificati dal virus.

E allora come è possibile che il RNA sia diverso? Ci sono 4^3 = 64 codoni differenti, dato che ci sono 4 caratteri nel RNA e ci sono tre di essi in ogni codone. Però, ci sono soltanto 20 aminoacidi diversi possibili. Questo vuole dire che più di un codone codifica per lo stesso aminoacido.

Il codice del RNA vaccinale è diverso, ma codifica gli stessi aminoacidi e perciò produce le medesime proteine. Se osserviamo con attenzione, notiamo che la maggioranza dei cambiamenti avviene in terza posizione nel codone, sopra annotata con un "3". E se guardiamo la tabella universale dei codoni, vediamo che in effetti spesso questa terza posizione è irrilevante ai fini di che aminoacido viene prodotto.
Quindi, i cambiamenti sono sinonimici... ma allora perché sono lì? Guardando attentamente vediamo che tutti i cambiamenti, tranne uno, aumentano il numero di C e G.
Perché uno vorrebbe fare questo? Come si diceva prima, il nostro sistema immunitario vede di pessimo occhio un RNA "esogeno", codice RNA che arriva dal di fuori della cellula. Per sfuggire al controllo, le U nell'RNA sono già state sostituite da Ψ.
Tuttavia, risulta che un RNA con maggiori percentuali di G e C viene anche convertito con maggior efficienza in proteine. E questo è stato ottenuto nel RNA del vaccino sostituendo altri caratteri con G e C tutte le volte che ciò è stato possibile.
Sono intrigato dall'unica modifica che non ha portato ad una ulteriore C o G, la modifica da CCA a CCU. Se qualcuno ne conosce la ragione, per favore, informatemene! Notate che so che alcuni codoni sono più comuni di altri nel genoma umano, ma ho anche letto che questo non influenza granché la velocità di traduzione.

La proteina Spike vera e propria

Anche i successivi 3777 caratteri del RNA del vaccino sono ottimizzati per aggiungere più C e G possibile. Per motivi di spazio non elencherò qui tutto il codice, e mi concentrerò su un pezzetto particolarmente speciale. Questo è il pezzetto che fa funzionare tutto, la parte che ci aiuterà a tornare a una vita normale:
                  *   *
          L   D   K   V   E   A   E   V   Q   I   D   R   L   I   T   G
Virus:   CUU GAC AAA GUU GAG GCU GAA GUG CAA AUU GAU AGG UUG AUC ACA GGC
Vaccine: CUG GAC CCU CCU GAG GCC GAG GUG CAG AUC GAC AGA CUG AUC ACA GGC
          L   D   P   P   E   A   E   V   Q   I   D   R   L   I   T   G
           !     !!! !!        !   !       !   !   !   ! !              
Qui vediamo i soliti cambiamenti di sinonimizzazione del RNA. Per esempio il primo codone CUU è stato cambiato in CUG. Questo aggiunge una G, che sappiamo aumentare la velocità di produzione delle proteine. Sia CUU che CUG codificano per l'aminoacido 'L', o Leucina, di conseguenza nella proteina nulla cambia.
Quando esaminiamo la proteina Spike nel vaccino e nel virus, tutti i cambiamenti sono dei sinonimi come questo… tranne due. E questi due li troviamo qui. Il terzo e quarto codone, sopra, rappresentano modifiche nel codice. Gli aminoacidi K e V sono entrambi sostituiti da 'P', ossia Prolina. Per la 'K', ciò richiede tre cambiamenti, indicati con !!!, e per la 'V' ne ha richiesti due ('!!').
E scopriamo che sono questi due cambiamenti a rendere il vaccino davvero efficace. Cosa è successo? Se guardiamo una vera particella di SARS-CoV-2 vediamo la proteina Spike sotto forma di una serie di punte (spike, appunto).
Le punte sono montate sul "corpo" virale (la "proteina nucleocapside"). Ma il fatto è che il nostro vaccino produce solo la proteina, e non la monta proprio su nessun corpo.
E se si lasciasse tale e quale, la proteina Spike libera collasserebbe su se stessa, fino a formare una struttura diversa. Se iniettassimo il vaccino con una sequenza intatta, ciò farebbe sì che il nostro corpo sviluppasse immunità, sì… ma alla proteina collassata. E il virus SARS-CoV-2 si presenta con la proteina dritta. Il vaccino non funzionerebbe un granché, in quel caso.

E allora cosa si fa? Nel 2017, è stato descritto come la sostituzione con un doppio ponte di Prolina nel punto giusto avrebbe reso le proteine S del SARS-CoV-1 e della MERS rigide come nella loro configurazione "pre-fusione", anche senza essere collegate al vero virus. Questo perché la Prolina è un aminoacido dalla struttura molto rigida. Funge da stecca, e stabilizza la proteina nello stato che dobbiamo far riconoscere al sistema immunitario.
Le persone che hanno scoperto questo dovrebbero andare in giro dandosi il cinque a palla. Dovrebbero emanare quantità insopportabili di compiacimento. E ne avrebbero il diritto. Se andiamo avanti nel codice, troviamo alcune modifiche alla fine della proteina Spike:
          V   L   K   G   V   K   L   H   Y   T   s             
Virus:   GUG CUC AAA GGA GUC AAA UUA CAU UAC ACA UAA
Vaccine: GUG CUG AAG GGC GUG AAA CUG CAC UAC ACA UGA UGA 
          V   L   K   G   V   K   L   H   Y   T   s   s          
               !   !   !   !     ! !   !          ! 
alla fine di una proteina troveremo un codone di "Stop", qui marcato con una s minuscola. Questo è un modo educato per dire che la proteina dovrebbe finire qui. Il virus originale usa il codone UAA per lo stop, il vaccino UGA, e ne mette due, forse per buona misura.
Per ulteriori dettagli rimando alla versione originale. E concludo facendo notare che la sequenza finale del vaccino è una serie di A: esattamente come per il codice sorgente del virus, questa indica la chiamata di uscita che segnala la fine del codice da eseguire. La sequenza di A si alterna con delle piccole sequenze di altri caratteri (nucleotidi), che probabilmente riflettono un qualche tipo di ottimizzazione proprietaria.

Questo vaccino è un'opera di ingegneria biomolecolare e la mia speranza è quella di aver reso più chiaro il suo utilizzo grazie all'analisi basata sulla metafora del codice sorgente di un software. La Natura è e resta il miglior sviluppatore di codice della storia del nostro pianeta.